ID: 1055719459

View in Genome Browser
Species Human (GRCh38)
Location 9:79155510-79155532
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055719452_1055719459 30 Left 1055719452 9:79155457-79155479 CCTGCATTGTAGAGACAAGCAAC No data
Right 1055719459 9:79155510-79155532 CTGTTTCACCACCTGGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055719459 Original CRISPR CTGTTTCACCACCTGGGGGC AGG Intergenic
No off target data available for this crispr