ID: 1055720293

View in Genome Browser
Species Human (GRCh38)
Location 9:79165682-79165704
Sequence TAGCCTCCTAACTCCAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055720286_1055720293 22 Left 1055720286 9:79165637-79165659 CCTTCCTTTAGATTTTCACTGGT No data
Right 1055720293 9:79165682-79165704 TAGCCTCCTAACTCCAACCAAGG No data
1055720284_1055720293 23 Left 1055720284 9:79165636-79165658 CCCTTCCTTTAGATTTTCACTGG No data
Right 1055720293 9:79165682-79165704 TAGCCTCCTAACTCCAACCAAGG No data
1055720287_1055720293 18 Left 1055720287 9:79165641-79165663 CCTTTAGATTTTCACTGGTTTGA No data
Right 1055720293 9:79165682-79165704 TAGCCTCCTAACTCCAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055720293 Original CRISPR TAGCCTCCTAACTCCAACCA AGG Intergenic
No off target data available for this crispr