ID: 1055720527

View in Genome Browser
Species Human (GRCh38)
Location 9:79168075-79168097
Sequence GACCCTAACCTGGTTCTCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055720527_1055720529 -4 Left 1055720527 9:79168075-79168097 CCAATGAGAACCAGGTTAGGGTC No data
Right 1055720529 9:79168094-79168116 GGTCTTGCTGTCTCTCGATGAGG No data
1055720527_1055720530 -3 Left 1055720527 9:79168075-79168097 CCAATGAGAACCAGGTTAGGGTC No data
Right 1055720530 9:79168095-79168117 GTCTTGCTGTCTCTCGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055720527 Original CRISPR GACCCTAACCTGGTTCTCAT TGG (reversed) Intergenic
No off target data available for this crispr