ID: 1055725574

View in Genome Browser
Species Human (GRCh38)
Location 9:79224621-79224643
Sequence CCTTGCAACCATCAGTTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055725565_1055725574 14 Left 1055725565 9:79224584-79224606 CCTTTGAAAAATTTTTAATAAGG No data
Right 1055725574 9:79224621-79224643 CCTTGCAACCATCAGTTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055725574 Original CRISPR CCTTGCAACCATCAGTTCTG GGG Intergenic
No off target data available for this crispr