ID: 1055725698

View in Genome Browser
Species Human (GRCh38)
Location 9:79226022-79226044
Sequence AAGTAGGAATGAAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055725698_1055725703 30 Left 1055725698 9:79226022-79226044 CCTCCTTCCCTTCATTCCTACTT No data
Right 1055725703 9:79226075-79226097 AGAGCCTCACTCTGTTGTCCAGG 0: 11
1: 613
2: 10219
3: 41725
4: 103633

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055725698 Original CRISPR AAGTAGGAATGAAGGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr