ID: 1055729965

View in Genome Browser
Species Human (GRCh38)
Location 9:79270463-79270485
Sequence TCTATGCTTTTGTGGCTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055729965_1055729972 25 Left 1055729965 9:79270463-79270485 CCTTACAGCCACAAAAGCATAGA 0: 1
1: 0
2: 1
3: 18
4: 173
Right 1055729972 9:79270511-79270533 TGTTAGAGATGAAGGGAAACTGG 0: 1
1: 0
2: 1
3: 42
4: 371
1055729965_1055729971 18 Left 1055729965 9:79270463-79270485 CCTTACAGCCACAAAAGCATAGA 0: 1
1: 0
2: 1
3: 18
4: 173
Right 1055729971 9:79270504-79270526 GATTGCATGTTAGAGATGAAGGG 0: 1
1: 0
2: 0
3: 22
4: 217
1055729965_1055729968 -5 Left 1055729965 9:79270463-79270485 CCTTACAGCCACAAAAGCATAGA 0: 1
1: 0
2: 1
3: 18
4: 173
Right 1055729968 9:79270481-79270503 ATAGAAAGATCAAGGAACAACGG 0: 1
1: 0
2: 1
3: 45
4: 603
1055729965_1055729970 17 Left 1055729965 9:79270463-79270485 CCTTACAGCCACAAAAGCATAGA 0: 1
1: 0
2: 1
3: 18
4: 173
Right 1055729970 9:79270503-79270525 GGATTGCATGTTAGAGATGAAGG 0: 1
1: 2
2: 0
3: 16
4: 221
1055729965_1055729969 -4 Left 1055729965 9:79270463-79270485 CCTTACAGCCACAAAAGCATAGA 0: 1
1: 0
2: 1
3: 18
4: 173
Right 1055729969 9:79270482-79270504 TAGAAAGATCAAGGAACAACGGG 0: 1
1: 0
2: 1
3: 25
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055729965 Original CRISPR TCTATGCTTTTGTGGCTGTA AGG (reversed) Intergenic
902331508 1:15733188-15733210 TCTAAGTTTTTGTGCCTGTCAGG - Intronic
903050842 1:20599752-20599774 TCAAGGCTTTGGTGGCAGTAGGG - Intronic
903198336 1:21711395-21711417 TCTAGTCTTTTGTGGCTAGAGGG - Intronic
905344177 1:37300297-37300319 TCTCTGGTTTTGTGGCTGGAAGG + Intergenic
906700916 1:47857439-47857461 TCTATGGTTCTGTGCCTGGAAGG - Intronic
907479099 1:54731744-54731766 TCTCTGTTTTTGTGGCAGGAGGG + Intronic
908429353 1:64040847-64040869 TATAAGCTTTTGTGGATATATGG - Intronic
909079954 1:71098219-71098241 TCTATGATTTTCTGTCTGCATGG + Intergenic
909511760 1:76461399-76461421 TTTATGCTTTTGAGGCTTAAGGG - Intronic
914943393 1:152042509-152042531 TGTGTGATTGTGTGGCTGTATGG + Intronic
915334839 1:155135219-155135241 TCTCTGCTAGTGTGGCTGTGGGG - Intergenic
916040052 1:160954122-160954144 TCTCTGCTTCTGTGGCTGTGAGG - Intronic
916239889 1:162628740-162628762 TCTCTGCTTTTGTGTTAGTAAGG + Intergenic
917092458 1:171367208-171367230 GCTATGCTATTGTGGTTGTTTGG - Intergenic
920943888 1:210510380-210510402 TTTGTGCTTTTGTGTCTGGATGG - Intronic
1063685599 10:8234725-8234747 TTTATGTTTTTGCAGCTGTATGG + Intergenic
1065634477 10:27716726-27716748 TCTAAACATTTGTGGTTGTACGG + Intronic
1065904384 10:30236511-30236533 TCTATTCTTCTGTGGCTCTGTGG - Intergenic
1067563605 10:47321348-47321370 TCTATGCTGGTGAGGCTGTCCGG - Intergenic
1068349622 10:55825567-55825589 TATATGTTTTTTTGGCTCTATGG - Intergenic
1069271461 10:66533233-66533255 TCTATGCTTTTCTTTCTGTAGGG + Intronic
1071725924 10:88198224-88198246 TCTACACGTTGGTGGCTGTATGG - Intergenic
1072602682 10:96944048-96944070 TCTATGCTTTTGTTATTGAATGG + Intronic
1073420978 10:103423439-103423461 TCTTTGCTTTTTTGGATCTAAGG + Intronic
1074034279 10:109722547-109722569 TCATTATTTTTGTGGCTGTATGG + Intergenic
1074655179 10:115578380-115578402 CCTAGGCTTTTGTTGCTGTTAGG + Intronic
1078447331 11:11414121-11414143 TCTAGGCTGTAATGGCTGTAGGG - Intronic
1079219446 11:18547176-18547198 TATATGCTTTTGTGGATCTGGGG - Intronic
1080600907 11:33819926-33819948 TTTATCCTTATGTGGCTGAAGGG - Intergenic
1083061726 11:59879969-59879991 TCTCTGCTTCTTTTGCTGTATGG - Intergenic
1084870186 11:72093443-72093465 TCTTTGCTTTTTTGGCTTTAGGG - Intronic
1086145050 11:83542468-83542490 TCTATGCGTATGTGTGTGTATGG + Intronic
1086252199 11:84829422-84829444 TGTATACTTTTGTGGTTATAAGG + Intronic
1089637267 11:119823092-119823114 TCTCTGCCTTTGTGGCAATATGG - Intergenic
1092992268 12:13914238-13914260 TCAGTGCTTTTTTGGCTTTAGGG - Intronic
1093376537 12:18434709-18434731 TCTATGCTGTTGTACTTGTATGG - Intronic
1094457396 12:30652393-30652415 TCTAGCCTTTTGTGGTTGCATGG - Intronic
1098403171 12:70095296-70095318 TCTAAGCTGATGTGGCTTTAGGG + Intergenic
1098473669 12:70874502-70874524 TCTTTGTTTTTGTGACTGAAAGG - Intronic
1098779854 12:74673055-74673077 TCTATCCTCTTGTGTTTGTATGG + Intergenic
1108127896 13:47264694-47264716 TCTTTTCTTTTATGGCTTTAGGG + Intergenic
1109746098 13:66624555-66624577 TCTGTGCTTTTCTGCCTGTAGGG - Intronic
1109798712 13:67347243-67347265 TCTCTATTTTGGTGGCTGTATGG + Intergenic
1109869852 13:68320774-68320796 ACTAAGCTTTTCTGGCAGTAGGG + Intergenic
1110498028 13:76191367-76191389 TCTGTGCTTCTGTGGCTTTGAGG + Intergenic
1111052358 13:82901449-82901471 ACTTTGCTTTTGTAGCTGTAGGG + Intergenic
1113014477 13:105812761-105812783 TCTCTGCTTCTGTCGCTGCATGG + Intergenic
1115921087 14:38374618-38374640 TGTAGACCTTTGTGGCTGTATGG - Intergenic
1117100995 14:52347270-52347292 TGTATGCTTTTTTGGCTACATGG - Intergenic
1118407367 14:65439271-65439293 TCTCTACTTTTGAGGCTATAAGG + Intronic
1121398995 14:93655213-93655235 CCTATGCTTTTGTGTTTTTAGGG + Exonic
1122596883 14:102899809-102899831 TCTTTGCTTTTTTGCCTGTCCGG + Intronic
1125012185 15:34890481-34890503 TCTATGTCTATTTGGCTGTATGG + Intronic
1125367000 15:38928198-38928220 TTTATTCTTTTGTGGCTATTGGG + Intergenic
1125382526 15:39102672-39102694 CCTCTGCTTCTGTGGCTGTATGG + Intergenic
1126418677 15:48447332-48447354 TCTATGTTTTTATGGGTGTAGGG - Intronic
1127151006 15:56075392-56075414 GCTATGCATGTGTGGGTGTAGGG + Intergenic
1135326509 16:21529287-21529309 TCTGTGCTTATCTGACTGTAAGG + Intergenic
1135680452 16:24452405-24452427 AGTGTGGTTTTGTGGCTGTAAGG - Intergenic
1138914050 16:61441002-61441024 TCTCTGTTGTTGTGGTTGTAAGG - Intergenic
1140577822 16:76193047-76193069 TCTATGGTTTTGTGTGTGTGTGG + Intergenic
1147296340 17:39485872-39485894 TCTATGGTTTTTTGTCTGTTTGG - Intronic
1150495299 17:65603312-65603334 TCTATGCATCTGTGGGGGTATGG + Intronic
1153173363 18:2342048-2342070 TCTATTCTGTTGTGGTTGGATGG - Intergenic
1155544602 18:26902537-26902559 TCTCTGCCTTTGTGGCTGACTGG + Intergenic
1157108333 18:44795729-44795751 TGTATGCTTTTGTATCTGTATGG - Intronic
1157527326 18:48393852-48393874 TCTATGCCTTTTTGGCTATCTGG - Intronic
1161555278 19:4938241-4938263 TCTATGCTTATGTGACTGTCTGG + Intronic
925799515 2:7584244-7584266 TCTGTGATTTAGTGGCTGTGTGG - Intergenic
927125280 2:20007727-20007749 TATATGCTTTTGTAGCTCCAGGG - Intronic
933068445 2:77828981-77829003 TCTTTCCTTTTGTGGCTTTTAGG + Intergenic
933123847 2:78577716-78577738 TCTATGCATTTGTGGATATTGGG + Intergenic
933421512 2:82052249-82052271 TCTATGCTATGTTGGCTCTAGGG - Intergenic
938107762 2:128544940-128544962 TCTTTGTTTTTGTGGATTTATGG + Intergenic
940035303 2:149306536-149306558 TTTATGCTTTTATGGCTGCTGGG + Intergenic
940074431 2:149725276-149725298 TCTGTGCTTTTGTGACTCTCTGG + Intergenic
940965274 2:159830345-159830367 TGTATGCTTTTGATGCTCTATGG + Intronic
942972101 2:181969720-181969742 TCTAAGAGTTTTTGGCTGTAAGG - Intronic
945598456 2:211826714-211826736 TGTATCCTTTTGTGGCTATCAGG - Intronic
946192566 2:218015315-218015337 TCTCTGCTTTTCTGGCTATAAGG - Intergenic
948341420 2:237255731-237255753 ACTATCCATTTGTGACTGTATGG - Intergenic
948605329 2:239131285-239131307 TCAAAGCATTTGTGGCTGGAGGG + Intronic
1169024406 20:2356864-2356886 TCTATGATTTAGTGGGTGTTGGG + Intergenic
1169133149 20:3178026-3178048 CCTATGCTGGTGAGGCTGTAGGG - Intergenic
1173684385 20:44912392-44912414 TCCATGCTCATGTGGCTGCAGGG + Intronic
1175034369 20:55985913-55985935 TCTATTTTTTTGTGCCTGTATGG - Intergenic
1176672325 21:9745897-9745919 TGTCTGCTTTTGTGGATGTCTGG + Intergenic
1181882450 22:25991859-25991881 TCTTTGCTTTTGCTGCTGTGAGG + Intronic
1182139117 22:27937505-27937527 TCCGTGATCTTGTGGCTGTATGG + Intergenic
1183098443 22:35568636-35568658 TGTCAGCTTTTGTGCCTGTAAGG + Intergenic
1184539012 22:45107432-45107454 TCCAAGCTCTTATGGCTGTAGGG + Intergenic
949980133 3:9497506-9497528 TCTACTCTTTTCTGCCTGTATGG + Intergenic
950285165 3:11739070-11739092 TCTATGCTTTGGTGTATGCAGGG + Intergenic
951124587 3:18968718-18968740 TCTTAGCTATTGTGGCTCTACGG + Intergenic
951690135 3:25386477-25386499 TTTTTGCTTTTCTGGCTGCAGGG + Intronic
952720096 3:36523687-36523709 TTCATGCTTCTGTGGCTGTCAGG - Intronic
955665737 3:61347532-61347554 CCTCTGCTTTTCTGTCTGTAAGG - Intergenic
956125628 3:66008526-66008548 TATGTGCGTTTGTGGTTGTATGG - Intronic
956199636 3:66692918-66692940 GCTCTGCTTTTCTAGCTGTATGG + Intergenic
956891039 3:73614345-73614367 TCCAAGCTTTTGAGGCTGGATGG - Intronic
957252915 3:77797081-77797103 CCTATGCTCTTGTAGTTGTAAGG + Intergenic
958545325 3:95541092-95541114 TCTATGCTTTTGTAAATATATGG - Intergenic
959204435 3:103286910-103286932 TCTATGAATTTTTGGCTGTTAGG + Intergenic
959348472 3:105230093-105230115 TTTATTCTTTTATCGCTGTAAGG + Intergenic
960461554 3:117942138-117942160 TCTGTGCTTTTTTGGATGGACGG - Intergenic
961119797 3:124364220-124364242 CCTAGGCTTTTGTGACTGTGAGG + Intronic
966106859 3:176345872-176345894 CCTTTGCTTCTGTGCCTGTAGGG + Intergenic
966288521 3:178326552-178326574 TCTATGCTTTTTTTCCTGGATGG - Intergenic
971911699 4:32803191-32803213 ACCATGCTCATGTGGCTGTACGG + Intergenic
971924648 4:32992249-32992271 TGTATTATTTTCTGGCTGTAGGG - Intergenic
971983742 4:33792140-33792162 TCTATGAGTATGTGGCTTTAAGG + Intergenic
973666644 4:53166357-53166379 TCTTTGCTTTTGTGGCAAAAAGG + Intronic
976098198 4:81531773-81531795 TCTTTGCTTTTGAGGTTATATGG + Intronic
976916665 4:90384467-90384489 TGTATGCCTTTCTGGCTGTTAGG + Intronic
977289601 4:95149893-95149915 TATCTGCTTCTGTGGTTGTATGG + Intronic
979205048 4:118029334-118029356 TTTATCTTTTTGTGGCTTTAGGG + Intergenic
979443075 4:120775826-120775848 TATGTGTATTTGTGGCTGTATGG - Intronic
980292805 4:130867603-130867625 TATATTCTTTTGTTGCTGTGTGG + Intergenic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
984049690 4:174849096-174849118 GCTATACTTTTGTGGAAGTAGGG - Intronic
984801360 4:183719932-183719954 TCTCTACTTTTGTGTCTGTTCGG - Intergenic
985307254 4:188556875-188556897 TCTATGGTTTTGTGACTGACAGG - Intergenic
985402406 4:189605951-189605973 TGTCTGCTTTTGTGGATGTCTGG - Intergenic
986635560 5:9818856-9818878 TCTATGTTGTTGGGGCTGTGTGG - Intergenic
987869037 5:23588748-23588770 TTTAGGTTTTGGTGGCTGTATGG - Intergenic
991397581 5:66221226-66221248 TCCATGCTTTTCTGGCTTTTAGG + Intergenic
991412112 5:66355889-66355911 TCTATGCTTTTGTGCCTGGATGG - Intergenic
991412124 5:66355982-66356004 TCTCTGCTTTTGTGCCTCGATGG - Intergenic
991542911 5:67749238-67749260 TCCATGCTTAAGTGTCTGTAAGG + Intergenic
992125603 5:73636827-73636849 TCTATGTTTCTGTGGAGGTAAGG + Intronic
992755387 5:79900377-79900399 TCTTTGCTATTGTGGTTGCAAGG + Intergenic
993807519 5:92430080-92430102 TTTATGTTTTTGTGGGAGTAGGG + Intergenic
994071217 5:95605069-95605091 TCTTTGCTTTTGTGGCTTTTGGG + Intergenic
994544510 5:101147495-101147517 TTTTTGTTTTTGTAGCTGTATGG + Intergenic
996380300 5:122856433-122856455 TATATGCGTATGTGGCTTTATGG + Intronic
996840892 5:127846418-127846440 AATATGCTTTTGTGGGCGTAAGG - Intergenic
999301816 5:150495857-150495879 TCTATCCTTTTATAGCTGTGTGG - Intronic
1000215956 5:159156470-159156492 TCTGTGCTGTTGTGGCTGGTGGG + Intergenic
1001193034 5:169647976-169647998 TCTCTGCATTTGGGGCTGGAGGG + Intronic
1001438623 5:171720543-171720565 TCTATTATTATGTGGCTTTAGGG - Intergenic
1008113158 6:47515659-47515681 CCTGTGCTTTTGAGGCTGTTGGG + Intronic
1010549611 6:77205293-77205315 TGTCTGGTTTGGTGGCTGTAGGG - Intergenic
1010998007 6:82555535-82555557 TCTATGCATGTGTGGCAGTCTGG + Intergenic
1011640630 6:89413065-89413087 TCAAGGCTTTTGTGGGAGTAGGG + Intergenic
1011880304 6:92015775-92015797 TCTATGCATATGTGGGTGCAGGG - Intergenic
1018460994 6:163998184-163998206 TCTATGCTGCTGTGGCTCTCAGG + Intergenic
1020883604 7:13794881-13794903 TCTATGCTGTTTTGGGTATATGG - Intergenic
1023684963 7:42724382-42724404 GCACTGCTTTTCTGGCTGTATGG - Intergenic
1023776506 7:43612863-43612885 TTTCTATTTTTGTGGCTGTATGG - Intronic
1026288230 7:68982823-68982845 TCCATGTGTTTGTGGCTGTGTGG - Intergenic
1026304341 7:69127048-69127070 TCTGTGCCTTTGAGGCTGTCTGG - Intergenic
1026539251 7:71266098-71266120 TCTCTGCATCTGTGGCTGCATGG + Intronic
1026548506 7:71346408-71346430 TTTATGTTTTTGTCGCTGTATGG + Intronic
1029100067 7:98122174-98122196 TATATGCTTTTGTGGAGGTCTGG + Intronic
1030978668 7:116160052-116160074 TCTTTACTTTTTTTGCTGTATGG + Intergenic
1032064807 7:128759637-128759659 TGTATGCATGTGTGTCTGTATGG - Intronic
1035403479 7:158583913-158583935 TTTGTGCTTTTGTGGCAGTAAGG + Intronic
1036284304 8:7430337-7430359 CCTATGGATTTGTGGCTGTCCGG + Exonic
1036337172 8:7881193-7881215 CCTATGGATTTGTGGCTGTCCGG - Exonic
1043727205 8:83625939-83625961 TATTTGGTTTTGTTGCTGTAAGG + Intergenic
1044038856 8:87340351-87340373 TCTTTGATTCTGTGTCTGTATGG + Intronic
1044555771 8:93560214-93560236 TTTATTCTTGTGTTGCTGTAAGG - Intergenic
1048024073 8:130568162-130568184 TCTATGTTTTTGTAGCGATAGGG + Intergenic
1048135272 8:131741671-131741693 TCTCTGCTTTTCTGGCGGAAGGG + Intergenic
1050842190 9:10165096-10165118 ACTGTGCTTTTGTTTCTGTAGGG - Intronic
1052418746 9:28213371-28213393 TCTGTATTTTTGTGGCTGCATGG - Intronic
1052611586 9:30782287-30782309 CCTTTCCTTTTGTGGCTTTAAGG - Intergenic
1052613490 9:30807640-30807662 GCTATGCATGTGTGGGTGTAAGG + Intergenic
1055729965 9:79270463-79270485 TCTATGCTTTTGTGGCTGTAAGG - Intergenic
1056205993 9:84319947-84319969 TCTATGAATTTTTGGCTGCAGGG - Intronic
1057097389 9:92324699-92324721 TTTATTCTTTTGTGACTATAAGG - Intronic
1059483040 9:114607070-114607092 TCTGTCCTGTTGTGTCTGTAAGG - Intergenic
1060321234 9:122562822-122562844 TTTATTCTTTTGTGGCAGCATGG - Intergenic
1061615356 9:131775449-131775471 CCTATACTTTTGGGGCTGTGGGG + Intergenic
1186429398 X:9491699-9491721 TCTAGGCTTTTGGGGCTGAATGG + Intronic
1187375885 X:18754305-18754327 TCAATGTTTTTGTGGCGGAATGG + Intronic
1189959692 X:46312601-46312623 ACAATGATTTTGTGGCTCTAAGG - Intergenic
1190083117 X:47372332-47372354 TTTATCCTTTTGGGGCTTTAGGG - Intronic
1190594508 X:52039124-52039146 TCTCAGCTTTGGTGGCTGCAGGG + Intergenic
1191633911 X:63355127-63355149 CCTATTGTTTTGTGGCTGAAGGG - Intergenic
1194002476 X:88449097-88449119 TCTAAACTTTTGTAGCTGTGTGG - Intergenic
1194658732 X:96604490-96604512 TCTATGGATTTTTGGCTGTGCGG + Intergenic
1197603064 X:128553581-128553603 TGTATGCTTTCCTGGCTGCAGGG - Intergenic
1197829680 X:130628042-130628064 TCCATGCTCTTGTCTCTGTAGGG - Exonic
1198300409 X:135328810-135328832 TCTATGTTTTTGTGGGTTTTTGG + Intronic
1198421571 X:136474169-136474191 TCTAGGCTTTTCCAGCTGTAGGG - Intergenic
1198640049 X:138746611-138746633 TCTATGCCCTTGTGGCTCTAGGG - Intronic
1199111693 X:143942881-143942903 TCTCTCCTTGTGTGGCTGCATGG + Intergenic
1199193845 X:145003858-145003880 TCTTTTCTTTTGTAGCTGTGAGG + Intergenic
1199686609 X:150270790-150270812 TCTCTGCCTCTCTGGCTGTAGGG + Intergenic
1201885377 Y:18875886-18875908 TCTATTCTCTTGCTGCTGTAAGG - Intergenic
1201903199 Y:19064146-19064168 TCTGTGTTTTTGTGTTTGTATGG + Intergenic
1202085378 Y:21131175-21131197 TCTAGGCTTTTAGGGCTGTAAGG + Intergenic