ID: 1055730381

View in Genome Browser
Species Human (GRCh38)
Location 9:79274475-79274497
Sequence AGATGTAAGCTGTAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055730377_1055730381 3 Left 1055730377 9:79274449-79274471 CCAATTTCAGAAGGGAGCAACTG No data
Right 1055730381 9:79274475-79274497 AGATGTAAGCTGTAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055730381 Original CRISPR AGATGTAAGCTGTAGGTGGA TGG Intergenic
No off target data available for this crispr