ID: 1055732418

View in Genome Browser
Species Human (GRCh38)
Location 9:79292046-79292068
Sequence CTCTGTTACCAGCACTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055732418_1055732423 -5 Left 1055732418 9:79292046-79292068 CCCATGGAGTGCTGGTAACAGAG No data
Right 1055732423 9:79292064-79292086 CAGAGCATTGCAGGTAGGCAGGG No data
1055732418_1055732421 -10 Left 1055732418 9:79292046-79292068 CCCATGGAGTGCTGGTAACAGAG No data
Right 1055732421 9:79292059-79292081 GGTAACAGAGCATTGCAGGTAGG No data
1055732418_1055732422 -6 Left 1055732418 9:79292046-79292068 CCCATGGAGTGCTGGTAACAGAG No data
Right 1055732422 9:79292063-79292085 ACAGAGCATTGCAGGTAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055732418 Original CRISPR CTCTGTTACCAGCACTCCAT GGG (reversed) Intergenic
No off target data available for this crispr