ID: 1055734386

View in Genome Browser
Species Human (GRCh38)
Location 9:79312183-79312205
Sequence CAGTGATACAAGAGGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055734381_1055734386 3 Left 1055734381 9:79312157-79312179 CCTCTATGGAGCTTGCTCCTCTG No data
Right 1055734386 9:79312183-79312205 CAGTGATACAAGAGGGAGGCCGG No data
1055734377_1055734386 12 Left 1055734377 9:79312148-79312170 CCTTCCCTCCCTCTATGGAGCTT No data
Right 1055734386 9:79312183-79312205 CAGTGATACAAGAGGGAGGCCGG No data
1055734379_1055734386 7 Left 1055734379 9:79312153-79312175 CCTCCCTCTATGGAGCTTGCTCC No data
Right 1055734386 9:79312183-79312205 CAGTGATACAAGAGGGAGGCCGG No data
1055734378_1055734386 8 Left 1055734378 9:79312152-79312174 CCCTCCCTCTATGGAGCTTGCTC No data
Right 1055734386 9:79312183-79312205 CAGTGATACAAGAGGGAGGCCGG No data
1055734380_1055734386 4 Left 1055734380 9:79312156-79312178 CCCTCTATGGAGCTTGCTCCTCT No data
Right 1055734386 9:79312183-79312205 CAGTGATACAAGAGGGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055734386 Original CRISPR CAGTGATACAAGAGGGAGGC CGG Intergenic
No off target data available for this crispr