ID: 1055734807

View in Genome Browser
Species Human (GRCh38)
Location 9:79315280-79315302
Sequence TACTCGACATCCACCCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055734807_1055734814 9 Left 1055734807 9:79315280-79315302 CCATGCTGGGTGGATGTCGAGTA No data
Right 1055734814 9:79315312-79315334 GGGCACAGAAGCAGAAGGGAGGG No data
1055734807_1055734811 4 Left 1055734807 9:79315280-79315302 CCATGCTGGGTGGATGTCGAGTA No data
Right 1055734811 9:79315307-79315329 GTTATGGGCACAGAAGCAGAAGG No data
1055734807_1055734815 23 Left 1055734807 9:79315280-79315302 CCATGCTGGGTGGATGTCGAGTA No data
Right 1055734815 9:79315326-79315348 AAGGGAGGGTGCGAAGCTCCAGG No data
1055734807_1055734812 5 Left 1055734807 9:79315280-79315302 CCATGCTGGGTGGATGTCGAGTA No data
Right 1055734812 9:79315308-79315330 TTATGGGCACAGAAGCAGAAGGG No data
1055734807_1055734813 8 Left 1055734807 9:79315280-79315302 CCATGCTGGGTGGATGTCGAGTA No data
Right 1055734813 9:79315311-79315333 TGGGCACAGAAGCAGAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055734807 Original CRISPR TACTCGACATCCACCCAGCA TGG (reversed) Intergenic
No off target data available for this crispr