ID: 1055739803

View in Genome Browser
Species Human (GRCh38)
Location 9:79375183-79375205
Sequence CTATAAAGATAAATCCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055739798_1055739803 7 Left 1055739798 9:79375153-79375175 CCAGTAAGACTAGCAACCCAGTA No data
Right 1055739803 9:79375183-79375205 CTATAAAGATAAATCCAGGAGGG No data
1055739797_1055739803 15 Left 1055739797 9:79375145-79375167 CCTGCAAACCAGTAAGACTAGCA No data
Right 1055739803 9:79375183-79375205 CTATAAAGATAAATCCAGGAGGG No data
1055739800_1055739803 -10 Left 1055739800 9:79375170-79375192 CCAGTAGAAAGATCTATAAAGAT No data
Right 1055739803 9:79375183-79375205 CTATAAAGATAAATCCAGGAGGG No data
1055739799_1055739803 -9 Left 1055739799 9:79375169-79375191 CCCAGTAGAAAGATCTATAAAGA No data
Right 1055739803 9:79375183-79375205 CTATAAAGATAAATCCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055739803 Original CRISPR CTATAAAGATAAATCCAGGA GGG Intergenic
No off target data available for this crispr