ID: 1055743137

View in Genome Browser
Species Human (GRCh38)
Location 9:79411632-79411654
Sequence CTCGGTGAACCCAAGAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055743137_1055743140 0 Left 1055743137 9:79411632-79411654 CCAAACTTCTTGGGTTCACCGAG No data
Right 1055743140 9:79411655-79411677 AGAAGGATGTCAAAGCCAGTTGG No data
1055743137_1055743143 24 Left 1055743137 9:79411632-79411654 CCAAACTTCTTGGGTTCACCGAG No data
Right 1055743143 9:79411679-79411701 TCCCAGAAAGGTGAGAATCCAGG No data
1055743137_1055743145 25 Left 1055743137 9:79411632-79411654 CCAAACTTCTTGGGTTCACCGAG No data
Right 1055743145 9:79411680-79411702 CCCAGAAAGGTGAGAATCCAGGG No data
1055743137_1055743141 12 Left 1055743137 9:79411632-79411654 CCAAACTTCTTGGGTTCACCGAG No data
Right 1055743141 9:79411667-79411689 AAGCCAGTTGGTTCCCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055743137 Original CRISPR CTCGGTGAACCCAAGAAGTT TGG (reversed) Intergenic
No off target data available for this crispr