ID: 1055746430

View in Genome Browser
Species Human (GRCh38)
Location 9:79450579-79450601
Sequence CCTGTTCAGCTGACAGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055746426_1055746430 25 Left 1055746426 9:79450531-79450553 CCATGGTGCTAATGCATTTGTTG No data
Right 1055746430 9:79450579-79450601 CCTGTTCAGCTGACAGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055746430 Original CRISPR CCTGTTCAGCTGACAGAGCA AGG Intergenic
No off target data available for this crispr