ID: 1055750783

View in Genome Browser
Species Human (GRCh38)
Location 9:79502529-79502551
Sequence AAATGTCCCCTGTAGTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055750783_1055750790 28 Left 1055750783 9:79502529-79502551 CCACCCAACTACAGGGGACATTT No data
Right 1055750790 9:79502580-79502602 TACAACTGGAATTGCGCATCTGG No data
1055750783_1055750792 30 Left 1055750783 9:79502529-79502551 CCACCCAACTACAGGGGACATTT No data
Right 1055750792 9:79502582-79502604 CAACTGGAATTGCGCATCTGGGG No data
1055750783_1055750788 1 Left 1055750783 9:79502529-79502551 CCACCCAACTACAGGGGACATTT No data
Right 1055750788 9:79502553-79502575 GCAGTGTCTGGAGACATTTTTGG 0: 28
1: 334
2: 732
3: 1082
4: 1303
1055750783_1055750791 29 Left 1055750783 9:79502529-79502551 CCACCCAACTACAGGGGACATTT No data
Right 1055750791 9:79502581-79502603 ACAACTGGAATTGCGCATCTGGG No data
1055750783_1055750789 14 Left 1055750783 9:79502529-79502551 CCACCCAACTACAGGGGACATTT No data
Right 1055750789 9:79502566-79502588 ACATTTTTGGTTGTTACAACTGG 0: 15
1: 163
2: 489
3: 814
4: 1142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055750783 Original CRISPR AAATGTCCCCTGTAGTTGGG TGG (reversed) Intergenic
No off target data available for this crispr