ID: 1055753106

View in Genome Browser
Species Human (GRCh38)
Location 9:79528758-79528780
Sequence GGAGAAAAAGAAATGCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055753106_1055753109 13 Left 1055753106 9:79528758-79528780 CCTCTGAGCATTTCTTTTTCTCC No data
Right 1055753109 9:79528794-79528816 ACTCCTTGAGTTCCTCACTGTGG No data
1055753106_1055753111 22 Left 1055753106 9:79528758-79528780 CCTCTGAGCATTTCTTTTTCTCC No data
Right 1055753111 9:79528803-79528825 GTTCCTCACTGTGGCCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055753106 Original CRISPR GGAGAAAAAGAAATGCTCAG AGG (reversed) Intergenic