ID: 1055753109 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:79528794-79528816 |
Sequence | ACTCCTTGAGTTCCTCACTG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1055753106_1055753109 | 13 | Left | 1055753106 | 9:79528758-79528780 | CCTCTGAGCATTTCTTTTTCTCC | No data | ||
Right | 1055753109 | 9:79528794-79528816 | ACTCCTTGAGTTCCTCACTGTGG | No data | ||||
1055753107_1055753109 | -8 | Left | 1055753107 | 9:79528779-79528801 | CCAGAAACCATTTCAACTCCTTG | No data | ||
Right | 1055753109 | 9:79528794-79528816 | ACTCCTTGAGTTCCTCACTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1055753109 | Original CRISPR | ACTCCTTGAGTTCCTCACTG TGG | Intergenic | ||