ID: 1055753111

View in Genome Browser
Species Human (GRCh38)
Location 9:79528803-79528825
Sequence GTTCCTCACTGTGGCCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055753106_1055753111 22 Left 1055753106 9:79528758-79528780 CCTCTGAGCATTTCTTTTTCTCC No data
Right 1055753111 9:79528803-79528825 GTTCCTCACTGTGGCCCAGAAGG No data
1055753107_1055753111 1 Left 1055753107 9:79528779-79528801 CCAGAAACCATTTCAACTCCTTG No data
Right 1055753111 9:79528803-79528825 GTTCCTCACTGTGGCCCAGAAGG No data
1055753108_1055753111 -6 Left 1055753108 9:79528786-79528808 CCATTTCAACTCCTTGAGTTCCT No data
Right 1055753111 9:79528803-79528825 GTTCCTCACTGTGGCCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055753111 Original CRISPR GTTCCTCACTGTGGCCCAGA AGG Intergenic
No off target data available for this crispr