ID: 1055757480

View in Genome Browser
Species Human (GRCh38)
Location 9:79571783-79571805
Sequence GGCCCGCCATGCGAGCGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055757480_1055757485 14 Left 1055757480 9:79571783-79571805 CCAGAGCGCTCGCATGGCGGGCC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1055757485 9:79571820-79571842 ATCTGGCCGTATTCTCAGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 89
1055757480_1055757488 23 Left 1055757480 9:79571783-79571805 CCAGAGCGCTCGCATGGCGGGCC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1055757488 9:79571829-79571851 TATTCTCAGGCAGGGTCGCCCGG 0: 1
1: 0
2: 0
3: 4
4: 84
1055757480_1055757489 24 Left 1055757480 9:79571783-79571805 CCAGAGCGCTCGCATGGCGGGCC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1055757489 9:79571830-79571852 ATTCTCAGGCAGGGTCGCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 151
1055757480_1055757484 10 Left 1055757480 9:79571783-79571805 CCAGAGCGCTCGCATGGCGGGCC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1055757484 9:79571816-79571838 GTCAATCTGGCCGTATTCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 49
1055757480_1055757486 15 Left 1055757480 9:79571783-79571805 CCAGAGCGCTCGCATGGCGGGCC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1055757486 9:79571821-79571843 TCTGGCCGTATTCTCAGGCAGGG 0: 1
1: 0
2: 0
3: 6
4: 85
1055757480_1055757482 -3 Left 1055757480 9:79571783-79571805 CCAGAGCGCTCGCATGGCGGGCC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1055757482 9:79571803-79571825 GCCGGTGATTGTAGTCAATCTGG 0: 1
1: 0
2: 0
3: 1
4: 25
1055757480_1055757491 28 Left 1055757480 9:79571783-79571805 CCAGAGCGCTCGCATGGCGGGCC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1055757491 9:79571834-79571856 TCAGGCAGGGTCGCCCGGGGCGG 0: 1
1: 0
2: 1
3: 12
4: 216
1055757480_1055757490 25 Left 1055757480 9:79571783-79571805 CCAGAGCGCTCGCATGGCGGGCC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1055757490 9:79571831-79571853 TTCTCAGGCAGGGTCGCCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055757480 Original CRISPR GGCCCGCCATGCGAGCGCTC TGG (reversed) Intronic