ID: 1055757607

View in Genome Browser
Species Human (GRCh38)
Location 9:79572628-79572650
Sequence TCTCGCGTGACACGGGCGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 26}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055757607_1055757617 -7 Left 1055757607 9:79572628-79572650 CCTGCCGCCCGTGTCACGCGAGA 0: 1
1: 0
2: 1
3: 1
4: 26
Right 1055757617 9:79572644-79572666 CGCGAGACCCGGCGGGGGCCGGG 0: 1
1: 0
2: 0
3: 21
4: 181
1055757607_1055757616 -8 Left 1055757607 9:79572628-79572650 CCTGCCGCCCGTGTCACGCGAGA 0: 1
1: 0
2: 1
3: 1
4: 26
Right 1055757616 9:79572643-79572665 ACGCGAGACCCGGCGGGGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 107
1055757607_1055757624 24 Left 1055757607 9:79572628-79572650 CCTGCCGCCCGTGTCACGCGAGA 0: 1
1: 0
2: 1
3: 1
4: 26
Right 1055757624 9:79572675-79572697 AGCCGCCCCTCAGACCGAGCCGG 0: 1
1: 0
2: 0
3: 3
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055757607 Original CRISPR TCTCGCGTGACACGGGCGGC AGG (reversed) Exonic
902153677 1:14465434-14465456 TCTCGCTTGACAGGGATGGCTGG + Intergenic
915447931 1:155984753-155984775 TCTCTGGTGACAGGGGAGGCTGG + Intronic
1063160487 10:3414896-3414918 CCTCGGCTGACACGGGCCGCAGG - Intergenic
1066461044 10:35612490-35612512 TCTGGCTTGACACGTGCAGCTGG + Intergenic
1082003983 11:47409713-47409735 TCTGGGGTGTCGCGGGCGGCAGG + Intronic
1111487290 13:88920235-88920257 TCTCGCCTGAGACAGGCTGCTGG + Intergenic
1135323901 16:21513856-21513878 TCTCGCGGGACTCTGGCTGCGGG - Intergenic
1136335386 16:29607124-29607146 TCTCGCGGGACTCTGGCTGCGGG - Intergenic
1142036113 16:87862965-87862987 TCTCGCGGGACTCTGGCTGCGGG - Intronic
1148207053 17:45785373-45785395 TGACGCCTGACACGAGCGGCGGG - Intronic
1152542399 17:80982798-80982820 CCTCGTGAGACAGGGGCGGCGGG + Intergenic
1152587279 17:81194682-81194704 TCTGCCGTGACCCGGGGGGCAGG - Intronic
1153815472 18:8786526-8786548 TCTCGAGTGACACTGCTGGCAGG + Intronic
1158436975 18:57440723-57440745 CCTTGGGTGACACGGGCCGCTGG + Intronic
1167209224 19:48122647-48122669 CCTGGCCCGACACGGGCGGCAGG + Intronic
1167346647 19:48949848-48949870 TCTGGCGAAACACGGGTGGCAGG - Intergenic
928549418 2:32356946-32356968 TCGCGCGTGCCACGCGCCGCGGG - Intergenic
947839458 2:233198299-233198321 TCTTGGGTGATATGGGCGGCTGG - Exonic
1175579450 20:60087618-60087640 TCGCGGGTAAAACGGGCGGCAGG - Intergenic
1175579489 20:60087758-60087780 TCGCGGGTAAAACGGGCGGCAGG - Intergenic
1185218155 22:49615392-49615414 TCTCGCGTGACACACGCGGCCGG - Intronic
967485342 3:190023609-190023631 TCTCCCTTGACATGGGCGGCGGG + Intronic
968763035 4:2452084-2452106 TCTCCCGTGACAGAGGCTGCTGG - Intronic
984715117 4:182917644-182917666 CCACGCGTGACCCGGGCAGCGGG - Intronic
1022560634 7:31345676-31345698 TCTCCAGTGACACTGGCTGCTGG + Intergenic
1022675413 7:32495265-32495287 GCTTACGTGACCCGGGCGGCTGG - Intronic
1036635415 8:10547163-10547185 TGTCGAGTGACAAGGGTGGCGGG - Intronic
1055757607 9:79572628-79572650 TCTCGCGTGACACGGGCGGCAGG - Exonic
1187394392 X:18907031-18907053 TCTCCCGGGGCTCGGGCGGCAGG + Exonic