ID: 1055757607 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:79572628-79572650 |
Sequence | TCTCGCGTGACACGGGCGGC AGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 29 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 1, 4: 26} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1055757607_1055757624 | 24 | Left | 1055757607 | 9:79572628-79572650 | CCTGCCGCCCGTGTCACGCGAGA | 0: 1 1: 0 2: 1 3: 1 4: 26 |
||
Right | 1055757624 | 9:79572675-79572697 | AGCCGCCCCTCAGACCGAGCCGG | 0: 1 1: 0 2: 0 3: 3 4: 71 |
||||
1055757607_1055757616 | -8 | Left | 1055757607 | 9:79572628-79572650 | CCTGCCGCCCGTGTCACGCGAGA | 0: 1 1: 0 2: 1 3: 1 4: 26 |
||
Right | 1055757616 | 9:79572643-79572665 | ACGCGAGACCCGGCGGGGGCCGG | 0: 1 1: 0 2: 0 3: 11 4: 107 |
||||
1055757607_1055757617 | -7 | Left | 1055757607 | 9:79572628-79572650 | CCTGCCGCCCGTGTCACGCGAGA | 0: 1 1: 0 2: 1 3: 1 4: 26 |
||
Right | 1055757617 | 9:79572644-79572666 | CGCGAGACCCGGCGGGGGCCGGG | 0: 1 1: 0 2: 0 3: 21 4: 181 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1055757607 | Original CRISPR | TCTCGCGTGACACGGGCGGC AGG (reversed) | Exonic | ||