ID: 1055757607

View in Genome Browser
Species Human (GRCh38)
Location 9:79572628-79572650
Sequence TCTCGCGTGACACGGGCGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 26}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055757607_1055757617 -7 Left 1055757607 9:79572628-79572650 CCTGCCGCCCGTGTCACGCGAGA 0: 1
1: 0
2: 1
3: 1
4: 26
Right 1055757617 9:79572644-79572666 CGCGAGACCCGGCGGGGGCCGGG 0: 1
1: 0
2: 0
3: 21
4: 181
1055757607_1055757616 -8 Left 1055757607 9:79572628-79572650 CCTGCCGCCCGTGTCACGCGAGA 0: 1
1: 0
2: 1
3: 1
4: 26
Right 1055757616 9:79572643-79572665 ACGCGAGACCCGGCGGGGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 107
1055757607_1055757624 24 Left 1055757607 9:79572628-79572650 CCTGCCGCCCGTGTCACGCGAGA 0: 1
1: 0
2: 1
3: 1
4: 26
Right 1055757624 9:79572675-79572697 AGCCGCCCCTCAGACCGAGCCGG 0: 1
1: 0
2: 0
3: 3
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055757607 Original CRISPR TCTCGCGTGACACGGGCGGC AGG (reversed) Exonic