ID: 1055757612

View in Genome Browser
Species Human (GRCh38)
Location 9:79572636-79572658
Sequence CCGTGTCACGCGAGACCCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 24}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055757601_1055757612 11 Left 1055757601 9:79572602-79572624 CCGGCACCCAGCCGCCGCCGCGC 0: 1
1: 0
2: 1
3: 55
4: 516
Right 1055757612 9:79572636-79572658 CCGTGTCACGCGAGACCCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 24
1055757604_1055757612 0 Left 1055757604 9:79572613-79572635 CCGCCGCCGCGCGTTCCTGCCGC 0: 1
1: 0
2: 4
3: 30
4: 282
Right 1055757612 9:79572636-79572658 CCGTGTCACGCGAGACCCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 24
1055757606_1055757612 -6 Left 1055757606 9:79572619-79572641 CCGCGCGTTCCTGCCGCCCGTGT 0: 1
1: 0
2: 1
3: 4
4: 40
Right 1055757612 9:79572636-79572658 CCGTGTCACGCGAGACCCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 24
1055757599_1055757612 19 Left 1055757599 9:79572594-79572616 CCCGGCAGCCGGCACCCAGCCGC 0: 1
1: 0
2: 3
3: 33
4: 332
Right 1055757612 9:79572636-79572658 CCGTGTCACGCGAGACCCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 24
1055757600_1055757612 18 Left 1055757600 9:79572595-79572617 CCGGCAGCCGGCACCCAGCCGCC 0: 1
1: 1
2: 0
3: 58
4: 404
Right 1055757612 9:79572636-79572658 CCGTGTCACGCGAGACCCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 24
1055757602_1055757612 5 Left 1055757602 9:79572608-79572630 CCCAGCCGCCGCCGCGCGTTCCT 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1055757612 9:79572636-79572658 CCGTGTCACGCGAGACCCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 24
1055757605_1055757612 -3 Left 1055757605 9:79572616-79572638 CCGCCGCGCGTTCCTGCCGCCCG 0: 1
1: 0
2: 1
3: 28
4: 163
Right 1055757612 9:79572636-79572658 CCGTGTCACGCGAGACCCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 24
1055757603_1055757612 4 Left 1055757603 9:79572609-79572631 CCAGCCGCCGCCGCGCGTTCCTG 0: 1
1: 0
2: 4
3: 21
4: 247
Right 1055757612 9:79572636-79572658 CCGTGTCACGCGAGACCCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055757612 Original CRISPR CCGTGTCACGCGAGACCCGG CGG Exonic
903412783 1:23159695-23159717 CAGTATCACGCCAGACGCGGTGG + Intronic
1072808048 10:98437865-98437887 ACGTGTCAAGGGAGACCTGGTGG + Intronic
1074518791 10:114198183-114198205 CCGTGTCACTAGAGACCAGATGG - Intronic
1113378510 13:109784364-109784386 CCGCGTCCCCCGAGACCCGGCGG + Exonic
1119601456 14:75979731-75979753 GCGTGTCACGGGAGAGCGGGTGG - Intronic
1122476958 14:102016975-102016997 CCATGTCAGGCAAGGCCCGGAGG - Exonic
1122666496 14:103333963-103333985 CCGGGTCTCGCGAGACCCAAGGG + Intronic
1125891272 15:43268882-43268904 CAGTGTCACGCGGGAGCCAGTGG - Intergenic
1147015541 17:37489318-37489340 CCGTGGCGCCCGAGACCCGGAGG - Intergenic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1148437518 17:47695052-47695074 GCGTGTCACGTGAGACGCGAGGG - Intronic
1160793800 19:934671-934693 CCGTCTCCCGCAAGACCCAGAGG - Intronic
1160978825 19:1807176-1807198 CCGTGCCACCCGGGACCTGGTGG - Exonic
1163441641 19:17324937-17324959 TCAAGTCACCCGAGACCCGGCGG - Exonic
1168678908 19:58299480-58299502 CCGTGTCAGGCCAGGCGCGGTGG + Exonic
1174410309 20:50330846-50330868 ACCTGTCAAGCGAGCCCCGGAGG + Intergenic
1180064561 21:45405782-45405804 CCGCGTCTCCCGAGACCCCGCGG - Intronic
1184767061 22:46577474-46577496 CCGTGACGCGCGGGACCCGGGGG - Intronic
1185157506 22:49203092-49203114 CCGTGCCACGTGGGAGCCGGTGG + Intergenic
968050048 3:195648029-195648051 CCGTGCATCGGGAGACCCGGTGG + Intergenic
971985134 4:33812384-33812406 ACGTGTCAAGAGAGACCAGGTGG + Intergenic
1006195070 6:32235172-32235194 CAGTGTCACTGGAGACCCCGTGG - Intergenic
1019603846 7:1898758-1898780 CCGAGTCACGCCTGACCCTGTGG - Intronic
1029415733 7:100442068-100442090 CCCTGTCACACGAGACACGCTGG + Intergenic
1049240102 8:141533345-141533367 CTGTGTCCCGCGGGACCCTGAGG + Intergenic
1055757612 9:79572636-79572658 CCGTGTCACGCGAGACCCGGCGG + Exonic
1062061398 9:134497407-134497429 CAGTGACACACGAGAACCGGAGG + Intergenic
1062611121 9:137373912-137373934 CCGTGTCCCGCGAGTGCCGCAGG - Intronic