ID: 1055757617

View in Genome Browser
Species Human (GRCh38)
Location 9:79572644-79572666
Sequence CGCGAGACCCGGCGGGGGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 181}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055757602_1055757617 13 Left 1055757602 9:79572608-79572630 CCCAGCCGCCGCCGCGCGTTCCT 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1055757617 9:79572644-79572666 CGCGAGACCCGGCGGGGGCCGGG 0: 1
1: 0
2: 0
3: 21
4: 181
1055757600_1055757617 26 Left 1055757600 9:79572595-79572617 CCGGCAGCCGGCACCCAGCCGCC 0: 1
1: 1
2: 0
3: 58
4: 404
Right 1055757617 9:79572644-79572666 CGCGAGACCCGGCGGGGGCCGGG 0: 1
1: 0
2: 0
3: 21
4: 181
1055757603_1055757617 12 Left 1055757603 9:79572609-79572631 CCAGCCGCCGCCGCGCGTTCCTG 0: 1
1: 0
2: 4
3: 21
4: 247
Right 1055757617 9:79572644-79572666 CGCGAGACCCGGCGGGGGCCGGG 0: 1
1: 0
2: 0
3: 21
4: 181
1055757599_1055757617 27 Left 1055757599 9:79572594-79572616 CCCGGCAGCCGGCACCCAGCCGC 0: 1
1: 0
2: 3
3: 33
4: 332
Right 1055757617 9:79572644-79572666 CGCGAGACCCGGCGGGGGCCGGG 0: 1
1: 0
2: 0
3: 21
4: 181
1055757605_1055757617 5 Left 1055757605 9:79572616-79572638 CCGCCGCGCGTTCCTGCCGCCCG 0: 1
1: 0
2: 1
3: 28
4: 163
Right 1055757617 9:79572644-79572666 CGCGAGACCCGGCGGGGGCCGGG 0: 1
1: 0
2: 0
3: 21
4: 181
1055757606_1055757617 2 Left 1055757606 9:79572619-79572641 CCGCGCGTTCCTGCCGCCCGTGT 0: 1
1: 0
2: 1
3: 4
4: 40
Right 1055757617 9:79572644-79572666 CGCGAGACCCGGCGGGGGCCGGG 0: 1
1: 0
2: 0
3: 21
4: 181
1055757604_1055757617 8 Left 1055757604 9:79572613-79572635 CCGCCGCCGCGCGTTCCTGCCGC 0: 1
1: 0
2: 4
3: 30
4: 282
Right 1055757617 9:79572644-79572666 CGCGAGACCCGGCGGGGGCCGGG 0: 1
1: 0
2: 0
3: 21
4: 181
1055757601_1055757617 19 Left 1055757601 9:79572602-79572624 CCGGCACCCAGCCGCCGCCGCGC 0: 1
1: 0
2: 1
3: 55
4: 516
Right 1055757617 9:79572644-79572666 CGCGAGACCCGGCGGGGGCCGGG 0: 1
1: 0
2: 0
3: 21
4: 181
1055757607_1055757617 -7 Left 1055757607 9:79572628-79572650 CCTGCCGCCCGTGTCACGCGAGA 0: 1
1: 0
2: 1
3: 1
4: 26
Right 1055757617 9:79572644-79572666 CGCGAGACCCGGCGGGGGCCGGG 0: 1
1: 0
2: 0
3: 21
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055757617 Original CRISPR CGCGAGACCCGGCGGGGGCC GGG Exonic