ID: 1055757624

View in Genome Browser
Species Human (GRCh38)
Location 9:79572675-79572697
Sequence AGCCGCCCCTCAGACCGAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055757608_1055757624 20 Left 1055757608 9:79572632-79572654 CCGCCCGTGTCACGCGAGACCCG 0: 1
1: 0
2: 0
3: 3
4: 21
Right 1055757624 9:79572675-79572697 AGCCGCCCCTCAGACCGAGCCGG 0: 1
1: 0
2: 0
3: 3
4: 71
1055757610_1055757624 17 Left 1055757610 9:79572635-79572657 CCCGTGTCACGCGAGACCCGGCG 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1055757624 9:79572675-79572697 AGCCGCCCCTCAGACCGAGCCGG 0: 1
1: 0
2: 0
3: 3
4: 71
1055757620_1055757624 -10 Left 1055757620 9:79572662-79572684 CCGGGACCGCCCGAGCCGCCCCT 0: 1
1: 0
2: 1
3: 16
4: 227
Right 1055757624 9:79572675-79572697 AGCCGCCCCTCAGACCGAGCCGG 0: 1
1: 0
2: 0
3: 3
4: 71
1055757607_1055757624 24 Left 1055757607 9:79572628-79572650 CCTGCCGCCCGTGTCACGCGAGA 0: 1
1: 0
2: 1
3: 1
4: 26
Right 1055757624 9:79572675-79572697 AGCCGCCCCTCAGACCGAGCCGG 0: 1
1: 0
2: 0
3: 3
4: 71
1055757618_1055757624 1 Left 1055757618 9:79572651-79572673 CCCGGCGGGGGCCGGGACCGCCC 0: 1
1: 0
2: 2
3: 36
4: 352
Right 1055757624 9:79572675-79572697 AGCCGCCCCTCAGACCGAGCCGG 0: 1
1: 0
2: 0
3: 3
4: 71
1055757611_1055757624 16 Left 1055757611 9:79572636-79572658 CCGTGTCACGCGAGACCCGGCGG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1055757624 9:79572675-79572697 AGCCGCCCCTCAGACCGAGCCGG 0: 1
1: 0
2: 0
3: 3
4: 71
1055757619_1055757624 0 Left 1055757619 9:79572652-79572674 CCGGCGGGGGCCGGGACCGCCCG 0: 1
1: 0
2: 2
3: 24
4: 212
Right 1055757624 9:79572675-79572697 AGCCGCCCCTCAGACCGAGCCGG 0: 1
1: 0
2: 0
3: 3
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055757624 Original CRISPR AGCCGCCCCTCAGACCGAGC CGG Exonic