ID: 1055760201

View in Genome Browser
Species Human (GRCh38)
Location 9:79598860-79598882
Sequence GCAAAACTGATCTGAACTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055760201_1055760203 21 Left 1055760201 9:79598860-79598882 CCTCGAGTTCAGATCAGTTTTGC 0: 1
1: 0
2: 0
3: 9
4: 70
Right 1055760203 9:79598904-79598926 CAGAGCTTCTAGTTTAGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055760201 Original CRISPR GCAAAACTGATCTGAACTCG AGG (reversed) Intronic
906778813 1:48554036-48554058 GCAAAACTCAGCTGAAGTCTGGG + Intronic
908060536 1:60343497-60343519 GCAAAACTGGTCTTATCTCCTGG - Intergenic
908874066 1:68649485-68649507 GCACAGCTGAACTGAACTCCAGG - Intergenic
909660678 1:78078353-78078375 GAAGAACTGATCTGAAGTCATGG + Intronic
912997959 1:114550536-114550558 GCAAAAGTCATCTGACCTCAGGG - Intergenic
913571331 1:120123070-120123092 GCCAAACTGACCTGAAATCTGGG - Intergenic
913574790 1:120161390-120161412 ACAAAACTGAACTGAAGTCTCGG + Intronic
914292143 1:146284047-146284069 GCCAAACTGACCTGAAATCTGGG - Intergenic
914553187 1:148734830-148734852 GCCAAACTGACCTGAAATCTGGG - Intergenic
920795218 1:209130452-209130474 GCAAAACTGATCTAAAGTGTTGG + Intergenic
924923796 1:248658680-248658702 GCAAAAGTCATCTTAACTTGCGG - Intergenic
1063421654 10:5916982-5917004 TCAAAACTGATCTTAACTGAAGG + Intronic
1063430817 10:5986471-5986493 ACAAAACTGGTCTGCTCTCGGGG + Intergenic
1064538274 10:16380178-16380200 GCAGACCTGATCTGAAGTCTAGG - Intergenic
1067787613 10:49262101-49262123 CAAAAACTGATCTGAACTGGTGG - Intergenic
1071950463 10:90697657-90697679 GCAAGACTGATGAGAACTCCAGG - Intergenic
1080529822 11:33163748-33163770 GCCAAGCTGGTCTGAACTCCTGG + Intergenic
1086877520 11:92114034-92114056 GAAAAACTAATCAGAACTCATGG + Intergenic
1089946831 11:122484022-122484044 TCAAAATTGAACTGAACTCATGG + Intergenic
1091332598 11:134741971-134741993 TAAAAGCTGATCTGAACTGGAGG - Intergenic
1095686607 12:45042964-45042986 GAAAAAATGATCTAAACTCGAGG + Intronic
1095760681 12:45831697-45831719 GAACAACTGAACTGAACTCATGG - Intronic
1096444760 12:51679336-51679358 GCAAAACTGATCTGCCCCAGGGG - Intronic
1101037428 12:100718732-100718754 GCAAAAATGTTCTGAGCACGGGG - Intronic
1104429175 12:128702903-128702925 GCAAACCAGGTCTGACCTCGTGG - Intronic
1116515765 14:45803254-45803276 GCAAAAGTGTTCTAAACTTGAGG + Intergenic
1121655203 14:95590066-95590088 ACAAAACTGATCTAAACCTGGGG + Intergenic
1125762634 15:42107476-42107498 GTAAATCTGATCTGAATTCTTGG - Intergenic
1129535661 15:76311742-76311764 TCAAAACTGAGCTGACCTCGGGG + Intergenic
1148162227 17:45456970-45456992 GCCACACTGGTCTGAACTCTTGG - Intronic
1150938939 17:69669284-69669306 GCAAAACTGCTCTGAGATCGTGG - Intergenic
1150966215 17:69972233-69972255 GCAAAACTGATCCAAATACGTGG - Intergenic
1158666581 18:59438274-59438296 GTAAAACTGAGCTGGACTCACGG + Intronic
1159425283 18:68276724-68276746 GCCAACCTGATTTGAACTCATGG + Intergenic
1168112461 19:54201213-54201235 GCAAAACTTATGTGACCCCGCGG + Exonic
928997425 2:37308137-37308159 GAAAAACTGATCTCAACACTTGG - Intronic
931665267 2:64606044-64606066 GCAAGACAGATCTGAACCCAGGG + Intergenic
933426604 2:82120941-82120963 CCAAAGATGATCTGAACTCTAGG + Intergenic
934939865 2:98492903-98492925 GCAGAACTGAACTGGACTCCAGG - Intronic
937088278 2:119186498-119186520 TCAAAACTGAACTGAATTAGAGG - Intergenic
937211411 2:120274427-120274449 GCAAATGTGATCTGGACTCCTGG + Intronic
939964316 2:148595547-148595569 GCCAAACTGAACTGAAGTTGGGG - Intergenic
941570928 2:167169399-167169421 GCAAAAGTGAACTGTACTTGAGG - Intronic
945521378 2:210832029-210832051 GAAAAACCGATCTGAACTTCTGG - Intergenic
948013805 2:234671596-234671618 GCCAAGCTGATGTGAGCTCGTGG - Intergenic
1172707582 20:36893669-36893691 GCTAAACTGTTCTGAACTTGTGG + Exonic
949255961 3:2046343-2046365 GCACATCTTGTCTGAACTCGAGG + Intergenic
952356046 3:32584994-32585016 GGCAAGCTGATCTGAACTCTAGG + Intergenic
967243208 3:187461791-187461813 GCAAAAATGACATGAACTAGAGG - Intergenic
977751461 4:100614502-100614524 GCAAAACACATTTGAACTCTTGG + Intronic
978524193 4:109647965-109647987 GCATAAGTGATCTGAACTAGAGG + Intronic
979866918 4:125767628-125767650 GCTAAACTGATCTAAAATCCAGG - Intergenic
984038820 4:174703672-174703694 GCAAAAGTCATCTCAACTCTAGG - Intronic
985804377 5:2031261-2031283 ACAAAACTTATCTGAATTCTTGG - Intergenic
988850248 5:35173516-35173538 GCAAGACTGACCTGAAGTCCAGG + Intronic
993049991 5:82915468-82915490 GAACTACTGATTTGAACTCGTGG - Intergenic
998548332 5:143051411-143051433 GTAAAACAGATCTAAACTAGAGG - Intronic
1004638331 6:17489795-17489817 GCAAAACAGATCTGCCCTCCTGG + Intronic
1006965914 6:37984778-37984800 GCTAAGCTGGTCTGAACTAGTGG + Intronic
1010523588 6:76873227-76873249 ACAAATCAGATCTGAACTGGAGG + Intergenic
1013836040 6:114336397-114336419 GCCAGACTGGTCTGAACTCCTGG - Intronic
1014412371 6:121142008-121142030 GCAAGACTGCTCTCTACTCGAGG + Intronic
1016494290 6:144642483-144642505 GCACAACTTATCTGAACAAGGGG - Intronic
1018643741 6:165929253-165929275 TCAAATCTGACCTGCACTCGAGG - Intronic
1022030233 7:26486118-26486140 ACAAAACTTTTCTGAACTCAGGG - Intergenic
1023413679 7:39912015-39912037 GAAAAACTAATCTGAACTTCTGG + Intergenic
1025609904 7:63068678-63068700 GCAGAACTGCTCTGGACTCGGGG - Intergenic
1033203387 7:139394156-139394178 ACAAAACTGATCTGAGCTTCTGG - Intronic
1038297751 8:26311592-26311614 GCACAACAGCTTTGAACTCGTGG - Intronic
1039287153 8:36054206-36054228 GCAAATCTGAACTGAAATCCAGG - Intergenic
1041049052 8:53915397-53915419 GAAAGACTGGTCTGAACTCCGGG - Intronic
1046899800 8:119511687-119511709 GCAAAACAGATCTCAATTTGAGG - Intergenic
1047550640 8:125869013-125869035 GCAAAAATGACCTGAACTAGTGG - Intergenic
1047826867 8:128585781-128585803 GAACCACTGATCTGACCTCGTGG + Intergenic
1055760201 9:79598860-79598882 GCAAAACTGATCTGAACTCGAGG - Intronic
1059074346 9:111176259-111176281 ACAAGAGTGATCTGAAATCGTGG - Intergenic
1060873703 9:127064313-127064335 GCAAACCTCATCTGAACTTGAGG - Intronic
1185956127 X:4492194-4492216 GGAAAACTGATTTGAGCTTGGGG + Intergenic
1188601371 X:31969952-31969974 GCAACGCTGATCTGAACAGGTGG - Intronic
1198146271 X:133860418-133860440 ACAAAACTGAACAGCACTCGGGG + Intronic