ID: 1055760203

View in Genome Browser
Species Human (GRCh38)
Location 9:79598904-79598926
Sequence CAGAGCTTCTAGTTTAGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055760201_1055760203 21 Left 1055760201 9:79598860-79598882 CCTCGAGTTCAGATCAGTTTTGC 0: 1
1: 0
2: 0
3: 9
4: 70
Right 1055760203 9:79598904-79598926 CAGAGCTTCTAGTTTAGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055760203 Original CRISPR CAGAGCTTCTAGTTTAGAGT AGG Intronic
No off target data available for this crispr