ID: 1055768611

View in Genome Browser
Species Human (GRCh38)
Location 9:79692076-79692098
Sequence CTCAAAACTAACATGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 214}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055768611 Original CRISPR CTCAAAACTAACATGGGGGA GGG (reversed) Intronic
900437363 1:2637558-2637580 CTCACAGCCAGCATGGGGGATGG - Intronic
902320794 1:15664066-15664088 CTCAAAAATAAAATGATGGAAGG - Exonic
904452504 1:30623247-30623269 CACAACACTAAGATGGGAGAGGG - Intergenic
906485643 1:46232725-46232747 CTAAAGACCAACATGGAGGAGGG - Intergenic
907825293 1:58011042-58011064 CTCATAACTAACATTTGGGTAGG - Intronic
907874583 1:58473244-58473266 TTCATAAATAACATGGGGGCCGG + Intronic
908321077 1:62979491-62979513 TTCAAAACTACCTTAGGGGATGG - Intergenic
909707477 1:78604673-78604695 CTCTAATCTCACATGGTGGAAGG - Intergenic
910406462 1:86896241-86896263 CTCAAAACAAAGAGGGGGGGAGG + Intronic
910778581 1:90901657-90901679 CTTACAACTTTCATGGGGGAGGG + Intergenic
913144780 1:115977825-115977847 CTCAACAGGAAGATGGGGGAAGG + Intronic
914400654 1:147316867-147316889 CTCAAAACTACCAGGAGGAAAGG - Intergenic
914460939 1:147884525-147884547 CTTAAAACTAACATGGTGTGGGG + Intergenic
915321667 1:155059968-155059990 CTCAAAGGTAGCATGGGGGTGGG + Exonic
916848981 1:168683799-168683821 CTCAGAACTAACAGGAGGAAAGG + Intergenic
917916193 1:179704828-179704850 CTGAGAACTACCATGCGGGAGGG + Intergenic
918340568 1:183565060-183565082 TTCAAAATAAAAATGGGGGAAGG + Intronic
918507524 1:185273030-185273052 CTCAAAAAAAAAAAGGGGGAGGG + Intronic
920274917 1:204797514-204797536 CGGAATACTAACATGGAGGAAGG - Intergenic
920581081 1:207108596-207108618 CTTAAAACTTACACGGAGGAAGG + Intronic
921501167 1:215905273-215905295 CTCAAAAGTAACATGTTGGTGGG - Intronic
922241853 1:223760530-223760552 CTAAAGCCTACCATGGGGGAAGG + Intronic
923057934 1:230441914-230441936 CTAAAAACTCACATTGTGGACGG + Intergenic
923308683 1:232712719-232712741 CTCCAGACTCACATGGGTGAAGG + Intergenic
923882714 1:238121354-238121376 CTCAAAACTACTATGGAGAAAGG + Intergenic
924141577 1:241029202-241029224 CACAAAATTACCATGGGGGGAGG + Intronic
1064491153 10:15859167-15859189 CTTAAAACAAACATGTGGGAGGG + Intronic
1067383889 10:45800585-45800607 CTCAAAAAAAAAGTGGGGGAGGG + Intergenic
1070663045 10:78321376-78321398 CTGAGAATTAACCTGGGGGATGG + Intergenic
1073105075 10:101028055-101028077 CTAAATAATAACATGGGGCAGGG + Intronic
1073574516 10:104611440-104611462 CTCAAAAATAACAAAAGGGATGG + Intergenic
1075546256 10:123357287-123357309 CTCAAAACCATTAAGGGGGAGGG - Intergenic
1076445020 10:130508579-130508601 CTCAATTCTCACGTGGGGGAAGG - Intergenic
1079091589 11:17484348-17484370 CTGTAAACTTACATGGTGGAAGG - Intergenic
1079526634 11:21397869-21397891 CTCTAACCTCACATGGTGGAAGG - Intronic
1081954111 11:47074535-47074557 ATCAAAACTAAGGTTGGGGAAGG + Intronic
1082046164 11:47729506-47729528 CTCAAAAATAAAGTGGGGGAAGG - Intronic
1083630037 11:64090695-64090717 CCCAAGACTAAAATGGGGGCAGG + Intronic
1084059058 11:66657736-66657758 CTCAAAAAAAAGGTGGGGGAGGG - Intronic
1086474190 11:87152733-87152755 CTCAAAAATAACATAAGGGCCGG - Intronic
1088908385 11:114171737-114171759 CTGAAAACTAAAGTGGGAGACGG - Intronic
1090770289 11:129913775-129913797 TTTAAAACTAACATGGGGACAGG - Intronic
1091407917 12:220552-220574 CACAACAGTAACATGGGGAAGGG + Intergenic
1092810620 12:12268135-12268157 CTCAAAACTACCCTGGGGAAAGG + Intergenic
1092913568 12:13169331-13169353 CTCTACCCTATCATGGGGGATGG + Intergenic
1093478012 12:19575916-19575938 GTCAAAACTCACATGCAGGAAGG - Intronic
1094332346 12:29308090-29308112 CTCAAAATTCACATGGGTGATGG + Intronic
1094581869 12:31740698-31740720 CTCAAAGCTAAACTGGGGGAGGG + Intergenic
1095405591 12:41863731-41863753 ATCTAAACTAACACGGGGCAAGG - Intergenic
1096303623 12:50454318-50454340 CACAAAACTACCATTGGGAAAGG - Exonic
1097015264 12:55981576-55981598 CTCAAAGCTAACAAGTGGAAGGG + Intronic
1097072770 12:56367447-56367469 CTTAAAAACAACATGGGGGCTGG + Intergenic
1097338687 12:58413384-58413406 CTCAAAAGAAACAAGAGGGATGG - Intergenic
1098130239 12:67342596-67342618 CTCAAAAAACACATGGGGAAGGG - Intergenic
1099630783 12:85142208-85142230 CTTAAAAGTTACCTGGGGGATGG - Intronic
1102030560 12:109737881-109737903 CTCAGAACAGAGATGGGGGAGGG + Intronic
1103216853 12:119208291-119208313 CTGAGTACTAACTTGGGGGAAGG - Intronic
1103231685 12:119336266-119336288 CTCGAAACCAACAAGGGAGAGGG + Intronic
1103360807 12:120352553-120352575 CTCAATAATCTCATGGGGGAAGG - Intronic
1103856691 12:123975017-123975039 GTCAGAACTACCATAGGGGAGGG - Intronic
1106274018 13:28186337-28186359 CTCAAAATTAACATAGGGTCAGG - Intronic
1106679519 13:31995810-31995832 CTCCAAACTAACATGAGGACTGG + Intergenic
1113572077 13:111365353-111365375 CTCTAAGCCAACATGGGGGGTGG + Intergenic
1114038171 14:18649093-18649115 CTCAAAATTCCCATGGGTGATGG + Intergenic
1114120444 14:19665949-19665971 CTCAAAATTCCCATGGGTGATGG - Intergenic
1116114271 14:40628502-40628524 CTCTAACCTCACATGGTGGAAGG - Intergenic
1118232226 14:63963647-63963669 CTCCAAGCCAAAATGGGGGAGGG + Intronic
1119890733 14:78180153-78180175 TTTAAAATAAACATGGGGGAGGG + Intergenic
1121153407 14:91659718-91659740 CTCAAAACTATTAGGGGTGATGG - Intronic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1129553528 15:76479863-76479885 CACAAAATCTACATGGGGGAGGG + Intronic
1130274110 15:82467674-82467696 CTCAAAGCAGACATGGGGGGTGG - Intergenic
1130588752 15:85199641-85199663 CTCAAAGCAGACATGGGGGGTGG - Intergenic
1131322846 15:91412193-91412215 CTCAAAACTAATCTGGGGAATGG + Intergenic
1131551588 15:93361998-93362020 CTGGAAATAAACATGGGGGAGGG - Intergenic
1133274083 16:4626077-4626099 CGTAAAACTCACATGGGGAATGG - Intronic
1134037642 16:11043517-11043539 CTCAAAATGAAAATGGGGAAAGG - Intronic
1134645357 16:15860706-15860728 CTCAACAATAAAATGGGGGTAGG - Intergenic
1138734578 16:59235614-59235636 CCCAAAACAAAATTGGGGGAAGG - Intergenic
1139126787 16:64088234-64088256 CCCAAAACTGTCATGGGGGCAGG - Intergenic
1143028881 17:3956337-3956359 CTCAAAACTCACACGGGGGCCGG - Intronic
1143262188 17:5607653-5607675 CTCAAAAATTACGTGGGGGCTGG + Intronic
1147179744 17:38676831-38676853 CCCCAAACTCACATGGGGAAGGG - Intergenic
1147597094 17:41724344-41724366 GTCAAAACAAACACGGGGGGCGG - Exonic
1148080379 17:44964697-44964719 CTCAAAACTAACAAGTGGGATGG + Intronic
1148552114 17:48556576-48556598 CTCAAAAAGAAAAAGGGGGAGGG - Intronic
1149375951 17:56044281-56044303 CTCACAACCACCATGGGAGAGGG - Intergenic
1153776606 18:8459729-8459751 CTCAAAAGTAACATTGGGGTGGG - Intergenic
1155247647 18:23925179-23925201 CTCAAACCTAACCTGGAGCAAGG + Intronic
1156698608 18:39796853-39796875 CTCAAAAAGAACAAGAGGGATGG - Intergenic
1158965733 18:62620578-62620600 TTAAAAACTAACATGGATGATGG + Intergenic
1159712144 18:71774059-71774081 CTGGAAACTAAAATGGGGGAGGG - Intronic
1159918820 18:74209254-74209276 CTTATAACTAACAGGGGGAATGG - Intergenic
1160947623 19:1651112-1651134 CTCCATTCTAAGATGGGGGATGG + Intronic
1162987408 19:14279753-14279775 CCCAAAACCAAAATGGGGGGTGG + Intergenic
1163935503 19:20438960-20438982 CTCAAAACTAGCAGGAGGAAAGG + Intergenic
1164268352 19:23643680-23643702 GTCAAAAATAAGTTGGGGGAAGG + Intronic
1166615627 19:44242467-44242489 CTCACAACTTAAAAGGGGGAGGG - Intronic
1167870394 19:52364657-52364679 CTTGAACCTCACATGGGGGAAGG - Intronic
925864676 2:8216737-8216759 CTCAAAATAAACATGTGGCAGGG + Intergenic
928062540 2:28129302-28129324 CTCAAAACTAACAGAGAGGAGGG - Exonic
929447544 2:42013511-42013533 CTAAAAACTAAGATTGGGGCTGG + Intergenic
929904835 2:46036660-46036682 CTCAAAACTCTCAGAGGGGAGGG + Intronic
930076970 2:47413997-47414019 ATCAAAACTAAAATGGGGGCCGG - Intronic
930605948 2:53493179-53493201 CTGTAAACTCACATGGGAGAAGG - Intergenic
935897758 2:107755950-107755972 CTCAAAACTACCCAGAGGGAAGG - Intergenic
937238279 2:120443513-120443535 GAGAAAACTAACATGGCGGAGGG - Intergenic
938272787 2:129990007-129990029 CTCAAAATTCCCATGGGTGATGG - Intergenic
938443446 2:131356110-131356132 CTCAAAATTCCCATGGGTGATGG + Intergenic
938969250 2:136417119-136417141 CTCAAAAATAAAATAGGGAAGGG + Intergenic
940891689 2:159041920-159041942 CTCAACTCGAACATGGGGTAGGG - Intronic
942290858 2:174468939-174468961 ATCAAAACTAACATTCTGGATGG + Exonic
943954041 2:194162981-194163003 ATCAAAACTTAAGTGGGGGAAGG - Intergenic
944434193 2:199669435-199669457 CTCAAAACTAAAATGAGGAGAGG - Intergenic
944576938 2:201099059-201099081 CTCAAAAAAAAAGTGGGGGAGGG - Intergenic
945283561 2:208060309-208060331 CTCAAAAGAAAAAGGGGGGAGGG - Intergenic
945718191 2:213384460-213384482 CTCAAATCTAAGATGGTGGAGGG + Intronic
946631414 2:221673048-221673070 CTTAAAAATAACATGGAGTAGGG - Intergenic
948048477 2:234961566-234961588 CTCAAAACCAACATGGAGGCCGG - Intronic
1169987818 20:11465654-11465676 CTCATAACTAACATGTTGAATGG - Intergenic
1170948407 20:20912190-20912212 CCCAAAGCTAGCTTGGGGGAAGG + Intergenic
1172103611 20:32501708-32501730 CTAAAAGAAAACATGGGGGATGG + Intronic
1172168399 20:32913308-32913330 CTGTAAACTTACATGGTGGAAGG + Intronic
1173179757 20:40796862-40796884 CTCAAAACATACCTGAGGGAAGG - Intergenic
1173233088 20:41217751-41217773 CTCAATACTACAATGAGGGAAGG - Intronic
1173573272 20:44092356-44092378 CTCAAAACTAACTGGGGGCCGGG + Intergenic
1174741853 20:53022001-53022023 CATAAAAGTAACATGGTGGAGGG + Intronic
1174810147 20:53638543-53638565 CTCAAAACTGCCATGGCGGGTGG - Intergenic
1180462296 22:15576134-15576156 CTCAAAATTCCCATGGGTGATGG + Intergenic
1182256165 22:29040178-29040200 CTCAAAAAAAAAAAGGGGGAGGG - Intronic
1183622977 22:38985664-38985686 CTCAAACTAAACAGGGGGGATGG + Intronic
1183629524 22:39024923-39024945 CTCAAACCAAACAGGGGGGATGG + Intronic
1183632982 22:39044793-39044815 CTCAAACTAAACAGGGGGGATGG + Intronic
1185153568 22:49180022-49180044 CTCAAAACCAGCAGGGGGTACGG - Intergenic
954013947 3:47668846-47668868 CTGCACACTAGCATGGGGGAAGG + Intronic
954975812 3:54693186-54693208 CTTAACACTAAAATGTGGGAAGG + Intronic
955380956 3:58437583-58437605 CTCAAAACAAACAAGAGTGATGG - Intergenic
957134665 3:76270533-76270555 CTTAAAAATAAAGTGGGGGATGG - Intronic
960147857 3:114222011-114222033 ATCTAAGCTAACATGAGGGAAGG - Intergenic
962432865 3:135336219-135336241 CTCAAAACCCACAAGGGAGAAGG + Intergenic
965339891 3:167476819-167476841 TTCAATACTTACATGAGGGATGG + Intronic
968635190 4:1674871-1674893 CTCAGAACTGCCAAGGGGGAGGG - Intronic
968940540 4:3635236-3635258 CTCAAAACCATCATGGAGGTGGG + Intergenic
969693870 4:8724109-8724131 CTGAAAAGAACCATGGGGGAAGG + Intergenic
970095619 4:12460157-12460179 CTCAAAGGTAACATGGAGGCTGG - Intergenic
970932007 4:21523085-21523107 CTGTAACCTAACATGGTGGAAGG - Intronic
974391857 4:61280572-61280594 TACAAAACTATCATTGGGGAAGG - Intronic
975975209 4:80087802-80087824 CTGAAATCTACCATGGGAGAAGG + Intronic
980635371 4:135495288-135495310 CTCATAACAATCATGGAGGAAGG - Intergenic
980682771 4:136186276-136186298 CTCAAAACTAAGATGGGGCAGGG + Intergenic
981194225 4:141900092-141900114 CACACAGCTGACATGGGGGAAGG - Intergenic
981255798 4:142659566-142659588 CTCAGAAACAACATGAGGGATGG + Intronic
982629808 4:157818807-157818829 TAAAAAAATAACATGGGGGAGGG + Intergenic
983726980 4:170940810-170940832 CTCAAAACTACCAGGAGGAAAGG - Intergenic
983803196 4:171961746-171961768 CTCAGAAGAAACAAGGGGGATGG + Intronic
985914865 5:2909620-2909642 CTCAAAAGCAACATGGGGACGGG + Intergenic
986498083 5:8367242-8367264 CTCAAAACTTACAAGGCTGAGGG - Intergenic
986668683 5:10125134-10125156 CTCAAAAAGAAAATTGGGGAAGG + Intergenic
987843585 5:23253455-23253477 TTCAAAACTGAAAGGGGGGAGGG - Intergenic
988610927 5:32724374-32724396 CACAAACCCAACTTGGGGGATGG - Intronic
988821230 5:34888129-34888151 CTGTAAACTCACATGGTGGAAGG - Intronic
990297476 5:54417124-54417146 GTGAAAACTCAGATGGGGGAGGG + Intergenic
990321924 5:54638304-54638326 CTAAAAAATAAAAAGGGGGAGGG + Intergenic
992095276 5:73357339-73357361 CTTAAAACCAACAAGGGGTAGGG - Intergenic
992200486 5:74379031-74379053 CTCAAAAGTACCATGGGCTAAGG + Intergenic
992742973 5:79792262-79792284 CTCAAATCTAGCATGGGGCCTGG + Intronic
993419688 5:87685320-87685342 CTCTAACCTCACATGGTGGAAGG + Intergenic
993775942 5:91995775-91995797 CACAAAAATGACATGGGGAAGGG - Intergenic
995267571 5:110181320-110181342 CTCAAATCTAACATGTTGGCTGG - Intergenic
996057306 5:118995549-118995571 CTCAAACAAAACAAGGGGGATGG - Intergenic
997153954 5:131530585-131530607 ATCAACAGTAACATGAGGGAAGG + Intronic
997444068 5:133928602-133928624 CTCAAAAAAAAAAAGGGGGAGGG + Intergenic
999575038 5:152966670-152966692 CTCAAAACTATCTTGTGGGTGGG - Intergenic
1000310827 5:160042952-160042974 CTCAAAATTAACACGGGGATGGG - Intronic
1000904563 5:166948813-166948835 CTCAAAAATAACATAAGCGAGGG - Intergenic
1001351617 5:170973138-170973160 CTAAAAACTTACAGGGGAGATGG - Intronic
1002101936 5:176862118-176862140 CTCAGAAATAACATGCGGGGTGG - Intronic
1004934006 6:20489962-20489984 CTCAAAAATTAAAAGGGGGACGG + Intronic
1005762429 6:28979780-28979802 CTGGAAACTTGCATGGGGGAAGG + Intergenic
1006589977 6:35147745-35147767 CTCAAAAGAAACGTGGGGGGAGG + Intronic
1008405949 6:51118618-51118640 CTCAGAACAAATATGGTGGAAGG + Intergenic
1008959477 6:57251569-57251591 CTATTAACTGACATGGGGGAAGG + Intergenic
1009465550 6:63964112-63964134 CTTCAAATTAAAATGGGGGAAGG - Intronic
1011032102 6:82934542-82934564 TGCAAAACTACCATGGGGGTGGG + Intronic
1011292717 6:85793207-85793229 CTCAGAACAAACAAGAGGGATGG - Intergenic
1012140656 6:95623172-95623194 ATCAAAACCAACAAGGAGGAGGG - Intergenic
1012468454 6:99541875-99541897 CTTCAAAATAAGATGGGGGATGG + Intergenic
1013318454 6:108963709-108963731 CTAAAAACCAACCTGGGGCAAGG - Intronic
1013665366 6:112342271-112342293 CTGATAACTTACATGGAGGAAGG + Intergenic
1017191771 6:151661870-151661892 CTTAAAACAATCATGGCGGAAGG - Intronic
1020697612 7:11434136-11434158 CACCAAACAATCATGGGGGATGG + Intronic
1021097773 7:16552673-16552695 CTCAAAACTAGCTTGAGAGATGG + Intronic
1022197268 7:28081328-28081350 ACCAACACCAACATGGGGGAAGG + Intronic
1022247079 7:28570854-28570876 CGCAGAACAAACATGGTGGAGGG + Intronic
1026325795 7:69308674-69308696 CAGAAAACTAACAAGAGGGAAGG + Intergenic
1026616274 7:71907545-71907567 CTCCAAAATCACATAGGGGAAGG - Intronic
1028538151 7:91912312-91912334 ATCAAAAGTAACAGGGGAGAAGG + Intergenic
1028880777 7:95877253-95877275 CCCAACACTAACTTGAGGGATGG + Intronic
1029077413 7:97946384-97946406 CTCAAAACCAAGATTGAGGAAGG + Intergenic
1030940582 7:115642450-115642472 CTCAAAATTGACATAGAGGATGG + Intergenic
1031971590 7:128068649-128068671 CTGAAATCAAACATGGAGGAAGG - Intronic
1033879455 7:145862803-145862825 CTCAGAACTACCATGGGGAAAGG - Intergenic
1033979912 7:147150966-147150988 CTCAGAACTAACATCGGCTAAGG + Intronic
1038125361 8:24667336-24667358 CTGAAAACTAACATTGGCAAGGG - Intergenic
1043534297 8:81184754-81184776 CTCAAAACTAACATTAGAAAAGG + Intergenic
1044147716 8:88738489-88738511 CTCAAAAAAAAAATGGGGGGGGG - Intergenic
1044230823 8:89775805-89775827 CTCAAAGGAAACATGGAGGATGG + Intronic
1044913230 8:97084380-97084402 CTCAAGAAAAAGATGGGGGAGGG - Intronic
1045098675 8:98825074-98825096 CGCAAAACTATATTGGGGGAGGG + Intronic
1048311425 8:133325227-133325249 CTTAAAACTAATATGTAGGAAGG - Intergenic
1050236314 9:3584732-3584754 CTTAAAACAAACATGGTGGCTGG + Intergenic
1051094027 9:13444481-13444503 CATAAAAAAAACATGGGGGAGGG - Intergenic
1051481365 9:17564788-17564810 CTGAAAAGGAACAAGGGGGAAGG + Intergenic
1052048055 9:23818279-23818301 CTAAATACTAACAAGTGGGAAGG + Intronic
1055277784 9:74639368-74639390 CTGCAAACTGACATGGGGAAGGG + Intronic
1055768611 9:79692076-79692098 CTCAAAACTAACATGGGGGAGGG - Intronic
1056119116 9:83469838-83469860 CAGAAAACTAAGATGGGGGGCGG + Intronic
1057468754 9:95339084-95339106 CTCTAACCTCACATGGTGGAAGG + Intergenic
1057912828 9:99033604-99033626 CTCAAAAATAAGATGGGGAGTGG - Intronic
1057979659 9:99647846-99647868 TTCAAGACTACCATGGGAGAGGG - Intergenic
1060693081 9:125682056-125682078 GTTAAAACAAACATAGGGGAGGG - Intronic
1060957814 9:127656386-127656408 CTTAAAACTGACTTGGGGCAGGG - Intronic
1187743916 X:22387633-22387655 CTCAGAGGTAACTTGGGGGAAGG + Intergenic
1188120323 X:26298162-26298184 CTCAAGACTAACATGTGCTAAGG + Intergenic
1191107756 X:56782564-56782586 CTTAAAAGCAACATGTGGGAAGG - Intergenic
1191644782 X:63468164-63468186 CTCAGAAATAACAAGAGGGATGG - Intergenic
1194026636 X:88760933-88760955 TTCAAACCTAACATGGATGAAGG - Intergenic
1194699092 X:97091874-97091896 CCCAAAACTTGCATGGTGGAGGG + Intronic
1195163963 X:102198912-102198934 CTCTAACCTCACATGGAGGAAGG - Intergenic
1195194898 X:102488183-102488205 CTCTAACCTCACATGGAGGAAGG + Intergenic
1196717452 X:118824722-118824744 CTGAGAAATAACAAGGGGGACGG + Intronic
1196785977 X:119421913-119421935 CTCAAAAATAAAAAGGGGGTGGG - Intronic