ID: 1055769402

View in Genome Browser
Species Human (GRCh38)
Location 9:79701336-79701358
Sequence CTAGCTGTTTCCGGTTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 60}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055769402_1055769404 2 Left 1055769402 9:79701336-79701358 CCTGCAAAACCGGAAACAGCTAG 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1055769404 9:79701361-79701383 TAAGAAAAATATAAAGTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055769402 Original CRISPR CTAGCTGTTTCCGGTTTTGC AGG (reversed) Intronic
905902956 1:41593955-41593977 CTGGCTGTTACCAGCTTTGCAGG - Intronic
907585825 1:55616934-55616956 CTAGCTGTTTCCTGCTTTGTTGG - Intergenic
1068170324 10:53384472-53384494 CTAGCTGTTTCAGGGTATGCAGG + Intergenic
1070388677 10:75949978-75950000 CTAGGTCCTTCCAGTTTTGCAGG + Intronic
1071264697 10:83954616-83954638 CCAGCTGTTTCCGTTTTTGTGGG + Intergenic
1079386543 11:19984997-19985019 CTGGCTGTTTAAGGATTTGCTGG + Intronic
1081524119 11:43912484-43912506 CTACCTGTTTCTTGTTTTACAGG - Intronic
1094033372 12:26039455-26039477 TTAGCTGTTTGCTGTTTTGGTGG + Intronic
1097388076 12:58974586-58974608 CTAGTTCTTTCCGGTGTTGGTGG - Intergenic
1111288268 13:86124814-86124836 CCATCTGTTTCCAGTTTTACAGG - Intergenic
1112569977 13:100585407-100585429 CCAGCTCTTTCAGGCTTTGCAGG - Intronic
1113553392 13:111211178-111211200 GTTGCTGTTTCCTGCTTTGCAGG + Intronic
1114976866 14:28112726-28112748 CTAGCTTTTTACAGTTCTGCAGG + Intergenic
1123193841 14:106597650-106597672 CAAGCTGTTTCAGATTTTCCTGG + Intergenic
1124021047 15:25923633-25923655 CTAGCTTTTGCCAATTTTGCAGG + Intergenic
1134635223 16:15786696-15786718 CTTGGTGTTTTCGGTTTTCCCGG + Exonic
1139974216 16:70796062-70796084 ATGGCTGTTGCCGGTTTTGTGGG - Intronic
1140987163 16:80169019-80169041 GTATCTGTTTCCCATTTTGCAGG + Intergenic
1150748618 17:67838084-67838106 GTAGATATTTCAGGTTTTGCAGG + Intronic
1153949954 18:10049894-10049916 CTAGCACTTCCCGGCTTTGCTGG - Intergenic
1155428916 18:25735319-25735341 CTAGCTGAACCCGGTTATGCTGG + Intergenic
1162273140 19:9632616-9632638 ATAGCTGCTTCTGGTTTTGGAGG - Intronic
1162416038 19:10538129-10538151 CTAGCTGTTTGTGGATTTGAGGG + Intergenic
1163272663 19:16263519-16263541 CTCGCTGGTTCCTGTTTTGGGGG - Intergenic
1164699122 19:30269885-30269907 CTAGCTGGTTCCAGTTTTCAGGG + Intronic
1164969428 19:32518633-32518655 CTAACTGTTGCTGGTGTTGCCGG + Intergenic
1167952399 19:53037874-53037896 CGATCTGTTTCCGGGTCTGCAGG + Intergenic
1168143081 19:54402569-54402591 CTGGCTGTTTCCAGTCTTGGGGG + Intergenic
926469869 2:13240974-13240996 CTAGCTATTTTCCATTTTGCTGG + Intergenic
931013581 2:57948452-57948474 TTAGCTGTATCCAGTTCTGCAGG + Intronic
931887761 2:66635705-66635727 ATAGCTATTTTAGGTTTTGCTGG + Intergenic
938709726 2:133965849-133965871 CTAGCTGTTTCAGGTTTATGGGG - Intergenic
940535848 2:154943108-154943130 CTTTCTGTTTCCGTTTTTCCTGG + Intergenic
946970664 2:225087478-225087500 CTACCTGCTTCCTGTTTAGCAGG - Intergenic
948606123 2:239136687-239136709 CTGGCTGCTTCAGGTTTTGCTGG - Intronic
1170612247 20:17924256-17924278 ATAGATGTTTCCGTTTTTCCAGG + Intergenic
1173244893 20:41329926-41329948 CCAGCTGTTTTTGTTTTTGCAGG - Intergenic
959020907 3:101186654-101186676 CTAGATGTTTTCAGTTTTTCTGG + Intergenic
965188010 3:165490064-165490086 CTTGCTGCCTCAGGTTTTGCTGG + Intergenic
967483838 3:190006936-190006958 CTATCTGTTTCCCCTTTTCCGGG - Intronic
971188892 4:24407907-24407929 GTAGCTGTCTCCCATTTTGCAGG - Intergenic
971860072 4:32090638-32090660 CTAGCTTTTTCAAGTTTTTCAGG - Intergenic
975182507 4:71363086-71363108 CTAGCTGTCTCCCATATTGCTGG + Intronic
975265349 4:72358421-72358443 CTAGCTGTTTCGGGACCTGCAGG - Intronic
977615423 4:99083089-99083111 CTACCTGTCTGCAGTTTTGCAGG + Intronic
981167056 4:141573059-141573081 CTGGCTGTTTTCAGTTTTTCTGG - Intergenic
981844512 4:149152272-149152294 CTGTCTGTTTCCTGTTTTCCTGG - Intergenic
987938605 5:24502547-24502569 CTGGCTGTTTGTGGTTTGGCAGG + Intronic
996815788 5:127571127-127571149 TTAGCTGTTTCCTGTGTTTCAGG + Intergenic
997883093 5:137607967-137607989 GGAGCTGTTTCCAGTTCTGCAGG + Intergenic
998356566 5:141542052-141542074 GTAGCTGTTTTTGGTTTTGGGGG - Intronic
1011797918 6:90977969-90977991 CTTGCTGTTCCTTGTTTTGCAGG - Intergenic
1030840569 7:114348564-114348586 CCAGCTGTTTCTGGTTCTTCTGG + Intronic
1032797147 7:135287131-135287153 CTAGGTGTTTCAGGTTGAGCTGG + Intergenic
1035930480 8:3774934-3774956 CTACCTGTTTCCCGTCTCGCTGG - Intronic
1038185848 8:25274075-25274097 CTTGCTGTTTCCTGTTTTATTGG + Intronic
1039584593 8:38695510-38695532 CTAGCTGTTGCCGGTACTGATGG - Intergenic
1041005563 8:53494335-53494357 TTAGCTGTTTAGAGTTTTGCTGG - Intergenic
1041149674 8:54918232-54918254 ATATCTGTTTCAGGTTTAGCTGG - Intergenic
1042160220 8:65885848-65885870 CTAGCTGTTTCCTGATTTCCAGG - Intergenic
1042967440 8:74370054-74370076 TTAGCAGTTTTTGGTTTTGCAGG - Intronic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1045810499 8:106215383-106215405 CTGGCTATTTCTGGTTTGGCAGG - Intergenic
1055769402 9:79701336-79701358 CTAGCTGTTTCCGGTTTTGCAGG - Intronic
1056464591 9:86841352-86841374 CAGGCTGTTTCCTGTTTTGTGGG - Intergenic
1190146172 X:47893416-47893438 CTACCTGTTTCCTGTCTTGTTGG - Intronic