ID: 1055771614

View in Genome Browser
Species Human (GRCh38)
Location 9:79722697-79722719
Sequence TAGAATTCTGAAGAGGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055771614_1055771622 25 Left 1055771614 9:79722697-79722719 CCATGCCCCTCTTCAGAATTCTA 0: 1
1: 0
2: 3
3: 19
4: 250
Right 1055771622 9:79722745-79722767 CCCAACACCATGTAATTTTCTGG 0: 1
1: 0
2: 1
3: 11
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055771614 Original CRISPR TAGAATTCTGAAGAGGGGCA TGG (reversed) Intronic
900272183 1:1796659-1796681 TGGAAGCCTGCAGAGGGGCAGGG + Intronic
900680016 1:3911558-3911580 AAGAACTCTGCAGAGGGGCTGGG - Intergenic
901743767 1:11359244-11359266 AAGATTGATGAAGAGGGGCAGGG + Intergenic
902005396 1:13227976-13227998 TGGAACTCTGAAGCTGGGCATGG + Intergenic
902346795 1:15824178-15824200 TAGAATTCTGAAGGTGAGCTGGG + Intergenic
903565473 1:24262093-24262115 TAGAAGTCTGAAATGGGGCTGGG + Intergenic
903786311 1:25863507-25863529 GACAATGATGAAGAGGGGCAGGG + Exonic
904343764 1:29855068-29855090 CTGAGTGCTGAAGAGGGGCAAGG - Intergenic
905548938 1:38820569-38820591 TAAAATTATGAAGAAAGGCAAGG + Intergenic
905965302 1:42088470-42088492 TAGAATCCTGAAAAGGGGTCAGG - Intergenic
906580426 1:46930956-46930978 AAGAATACTGAGGAAGGGCAAGG - Intronic
908658580 1:66414148-66414170 TGCAATTCTGAAGAGGAACAGGG - Intergenic
909842025 1:80338962-80338984 TATAATTCTGAATAGGTGCGAGG - Intergenic
911862717 1:102974019-102974041 CACAATTCTGGAGAGGGGCAGGG - Intronic
916312071 1:163408867-163408889 TGGATTTTTGGAGAGGGGCAAGG + Intergenic
916360137 1:163958999-163959021 TGGGATTCTGCAGATGGGCAAGG + Intergenic
916389924 1:164320568-164320590 CAGAATAGTGAAGAGGGGAACGG + Intergenic
916459634 1:165009997-165010019 TGGAATTCAGAAGAGAGGCCAGG - Intergenic
917250074 1:173049368-173049390 TAGATTTCTGAAGAAGAGGAAGG - Intronic
919896459 1:202012483-202012505 TAGCACTCTGTGGAGGGGCAGGG - Intronic
919929074 1:202209351-202209373 TGGATTTCTGAGGAGGAGCAGGG - Intronic
920903185 1:210132807-210132829 TAGAATCCAGAAGAGAGGCTAGG - Intronic
921271438 1:213473886-213473908 TGCATTTCAGAAGAGGGGCATGG + Intergenic
923507738 1:234620771-234620793 TAGAATTTGGAAGAGTGGCTGGG + Intergenic
924045588 1:240025775-240025797 ACCAATTCTGCAGAGGGGCAGGG + Intronic
924116572 1:240753495-240753517 TAGAAATATGGAGAGGGGCCAGG - Intergenic
1063068278 10:2632331-2632353 TTGACTTATGAAGAGGAGCATGG - Intergenic
1063718908 10:8558550-8558572 TAAAATTTTTAAGAGGGCCAGGG - Intergenic
1064385354 10:14886219-14886241 TAGTATTCTGAAGAGGGAAATGG - Intronic
1065422242 10:25558106-25558128 TAGATTTCTGAAAAGAGGCTTGG + Intronic
1065918986 10:30374479-30374501 TAGAACTCAGAATAGGGGCGTGG + Intergenic
1067523617 10:47025865-47025887 TAGCTTCCTGAAGAGGGGCACGG + Intergenic
1067664109 10:48258585-48258607 TGGAATCCTGAAGAGTGGTAGGG - Intronic
1068650128 10:59513391-59513413 TAGACTTCTAAGGATGGGCAGGG - Intergenic
1068887952 10:62116697-62116719 TAGTATTCTGAGGCCGGGCACGG - Intergenic
1070931655 10:80265114-80265136 GTGAATTCTGAGGAAGGGCAAGG - Intergenic
1072129022 10:92474357-92474379 TAGATTTCTGCAGAAGGGCTGGG - Intronic
1073616458 10:105001349-105001371 TCAAATACTGTAGAGGGGCAAGG + Intronic
1075466028 10:122650771-122650793 TAGAAATCTGCAGTGGTGCATGG - Intergenic
1076199779 10:128548862-128548884 TTGAATTCTGAAGGGTGGCTTGG + Intergenic
1076651246 10:131989898-131989920 TAGAAATTGGAAGAGAGGCAAGG + Intergenic
1078559325 11:12356914-12356936 CAGAATTCTGAACAAGGGCAGGG + Intronic
1079261491 11:18886855-18886877 TATAATTGTCAAGAGTGGCAGGG + Intergenic
1080671298 11:34381152-34381174 TAGTATTTTCAAGAGGGGTAAGG + Intergenic
1081479331 11:43470432-43470454 TAGAGTCCTGGAGAGGGACATGG + Intronic
1085640718 11:78191007-78191029 GAGAGTTCTGAGCAGGGGCATGG + Intronic
1086184266 11:83994847-83994869 CAGAATCCAGAAGAGGGGCATGG - Intronic
1087045595 11:93841474-93841496 TAGAGTTTTGAAGAGGGTGAAGG - Intronic
1087385142 11:97461414-97461436 TAGAAATCTGAACAGGTGCCAGG - Intergenic
1087396087 11:97600976-97600998 GAAAAATCTGAAGAGAGGCAGGG + Intergenic
1089125616 11:116174566-116174588 GAGAATTCTGGAGAGGGACACGG + Intergenic
1089344910 11:117784966-117784988 TGGAATTCTGCAGAGCTGCAGGG - Intronic
1089835414 11:121366039-121366061 CAGAATTCTGAAGAGAGAGAAGG - Intergenic
1090482934 11:127083918-127083940 TAGAAATCTAGAGAGGGGCTGGG + Intergenic
1090560801 11:127929969-127929991 AAGAATTCTGGAGATGGTCATGG + Intergenic
1091744608 12:2982961-2982983 GGGAATTCTGAGGAGGAGCAGGG + Intronic
1094001657 12:25701607-25701629 TAGAAATCTGCAGAGGGGGCTGG + Intergenic
1096272007 12:50172849-50172871 TAGAATCATGAACAGGGGCCAGG - Intergenic
1099014305 12:77325749-77325771 GAGAATCCCGAAGAGGGGCGGGG - Intergenic
1099177024 12:79433907-79433929 AAGAATTCTCAGGTGGGGCATGG - Intronic
1099736603 12:86575158-86575180 AATAATTTTGAAGAAGGGCAAGG - Intronic
1100394968 12:94177637-94177659 TAGAACTCTGAATTGTGGCAAGG - Intronic
1100934796 12:99650614-99650636 TAGAATTCTAAATAGCGTCAGGG - Intronic
1101821118 12:108184951-108184973 TTGAGCTCTGAAGAGGGACAGGG + Intronic
1103670815 12:122613793-122613815 CAGGATTCTGAGTAGGGGCAGGG - Intronic
1103974966 12:124696469-124696491 CATTATTCTCAAGAGGGGCATGG + Intergenic
1107731700 13:43355664-43355686 GAGCATTCTGGAAAGGGGCAGGG + Intronic
1108597188 13:51959747-51959769 TAGAACACTCAAGAGTGGCATGG + Intronic
1108669525 13:52670514-52670536 TAGAATTCACAAGTCGGGCACGG + Intronic
1109708718 13:66135441-66135463 TAGTATTCTAAAGAGGATCACGG + Intergenic
1109833750 13:67827893-67827915 TTAAAATCTGAAGATGGGCATGG - Intergenic
1112188018 13:97146638-97146660 TTGGATTCTGAACAGGGGAAAGG - Intergenic
1113579444 13:111418681-111418703 TTGAATGCTGAAGAGGGCAATGG + Intergenic
1113976702 13:114232825-114232847 TAGAAGTCTGATGATGGGCCCGG - Intergenic
1115986094 14:39104563-39104585 TACAATCCTGAAGAGGGCAATGG + Intronic
1121732836 14:96198188-96198210 TAGAATTAGGAAGAGTGGCCAGG + Intergenic
1123179398 14:106454173-106454195 TAGATTTCAGAAGATGTGCATGG - Intergenic
1123194347 14:106601948-106601970 GGGAATCCTGAGGAGGGGCAGGG + Intergenic
1123222305 14:106868256-106868278 GGGAATCCTGAGGAGGGGCAGGG + Intergenic
1123667347 15:22617885-22617907 TAGAATGCGGAATAGGGGCGTGG + Intergenic
1123683050 15:22776151-22776173 TAGAATGCAGAAAAGGGGCGTGG + Intronic
1123763079 15:23447274-23447296 TAGAATGCAGAATAGGGGCGTGG + Intergenic
1124334802 15:28848675-28848697 TAGAATGCGGAAAAGGGGCGTGG + Intergenic
1124481309 15:30082902-30082924 TAGAATGCGGAATAGGGGCGTGG - Intergenic
1124487764 15:30134998-30135020 TAGAATGCGGAATAGGGGCGTGG - Intergenic
1124522287 15:30414291-30414313 TAGAATGCGGAATAGGGGCGTGG + Intergenic
1124536377 15:30551927-30551949 TAGAATGCGGAATAGGGGCGTGG - Intergenic
1124542855 15:30603975-30603997 TAGAATGCGGAATAGGGGCGTGG - Intergenic
1124562815 15:30791424-30791446 TAGAATGCAGAATAGGGGCGTGG - Intergenic
1124755764 15:32403323-32403345 TAGAATGCGGAATAGGGGCGTGG + Intergenic
1124762274 15:32455665-32455687 TAGAATGCGGAATAGGGGCGTGG + Intergenic
1124776355 15:32593403-32593425 TAGAATGCGGAATAGGGGCGTGG - Intergenic
1124960498 15:34389820-34389842 TAGAATGCAGAATAGGGGCGTGG + Intronic
1124977127 15:34536041-34536063 TAGAATGCAGAATAGGGGCGTGG + Intronic
1126170343 15:45690359-45690381 TAGAATGCAGAAGAGTGGCTGGG - Intronic
1128989936 15:72251155-72251177 TAAATTTCTGGTGAGGGGCAGGG - Intronic
1129028984 15:72605069-72605091 TAGAACACAGAATAGGGGCATGG - Intergenic
1129157294 15:73726516-73726538 CACAGTACTGAAGAGGGGCAGGG + Intergenic
1129599449 15:76989769-76989791 CAGCCTTCTGAAGAGGGGCAGGG - Intergenic
1130686181 15:86039847-86039869 CAGAATTCTGAAGATGGGCCAGG - Intergenic
1130815032 15:87422218-87422240 TAGTGTGCTGAAGATGGGCAAGG + Intergenic
1130958137 15:88641497-88641519 TAGAATCTGGGAGAGGGGCAGGG - Intronic
1131187937 15:90291847-90291869 TAGAATGCAGAATAGGGGCGTGG - Intronic
1132184324 15:99791011-99791033 TAGAATGCAGAACAGGGGCGTGG - Intergenic
1132434051 15:101782135-101782157 TAGAATGCAGAACAGGGGCGTGG + Intergenic
1132439302 15:101842643-101842665 TAAAATTAGGAAGAGGGGGAGGG - Intergenic
1132620108 16:861649-861671 TAGAATTATGAAGCGAGGCCGGG - Intronic
1135394710 16:22122346-22122368 TAGAAATCTGAACAGGTGGAAGG + Intronic
1137706226 16:50537607-50537629 TTGTATTCAGGAGAGGGGCATGG + Intergenic
1138149499 16:54643044-54643066 TATAATTTTAATGAGGGGCATGG - Intergenic
1139848395 16:69936188-69936210 TAGAATCCTGAACAGTGACAGGG - Intronic
1141021155 16:80497786-80497808 TGGAAATCTGAAGAGCTGCAAGG - Intergenic
1141852187 16:86653998-86654020 TAGAATTATGAGAAGGGACAAGG - Intergenic
1142346236 16:89555775-89555797 TAGAACTCAGGAGAGGTGCACGG + Intronic
1142677794 17:1525406-1525428 TACAATTCTGAAGTGGGCTATGG - Intronic
1143577353 17:7802013-7802035 AAGAAGTATGAAGGGGGGCAGGG + Exonic
1144932209 17:18868850-18868872 TAAAATCCTGTAGAGGGGCCAGG - Intronic
1145274784 17:21422942-21422964 TAGGAGTGTGAAGAGGGGCAAGG + Intergenic
1145312635 17:21708841-21708863 TAGGAGTGTGAAGAGGGGCAAGG + Intergenic
1145938825 17:28730619-28730641 GAGTTTTCTGAAAAGGGGCAGGG + Intronic
1145957243 17:28862923-28862945 AAGAGCTCTGAAGAGGGGCTAGG - Intergenic
1146647473 17:34584697-34584719 TAGAGGGCAGAAGAGGGGCAGGG + Intronic
1147299081 17:39509745-39509767 TATAACTCTGAAGAGAGGTAAGG + Exonic
1148111287 17:45145880-45145902 TAGAATTCTGTCAAGGGGCCAGG - Intergenic
1148390761 17:47270745-47270767 TAGAATTTTAAAGTTGGGCAAGG + Intronic
1148711383 17:49683817-49683839 AAGAATTCTGAAGAAGGGCACGG - Intergenic
1149964609 17:61149580-61149602 GAGATTTGTGAACAGGGGCAAGG + Intronic
1155872937 18:31049673-31049695 TAGAATTCAGCAGAGGTGAAAGG - Intergenic
1156946116 18:42833907-42833929 TAGCTTTGTGAAGAGGGGAAGGG + Intronic
1157343973 18:46806644-46806666 AAGAATTCTTAAGCTGGGCATGG - Intergenic
1158518743 18:58152673-58152695 TGGAAGTCTGAAGTGGGGCTTGG + Intronic
1159428567 18:68321415-68321437 TAGAAGTCTGATGAGTTGCAGGG + Intergenic
1160786502 19:902312-902334 TACAATTGTGAAGACGGGCTGGG + Intronic
1161462628 19:4407655-4407677 TAGGATGTTGAAGCGGGGCATGG + Intronic
1162084568 19:8240806-8240828 CAGACCCCTGAAGAGGGGCAGGG + Intronic
1164401783 19:27907302-27907324 TAGCATTTTCAAGAGAGGCAGGG + Intergenic
1164441251 19:28282305-28282327 GAAAATGGTGAAGAGGGGCAGGG - Intergenic
1165078024 19:33291524-33291546 CACAATTATGAAGAGGGGCTGGG - Intergenic
927189939 2:20510645-20510667 TGGAATTCTGAAGATGTGCCAGG + Intergenic
931198339 2:60074006-60074028 CAGAGTGCTGAAGAGGGCCAGGG - Intergenic
933328194 2:80864588-80864610 TAGATTTCTAAAAATGGGCAAGG + Intergenic
937845764 2:126577128-126577150 CAGAATTCTGGAGAGGAACAGGG + Intergenic
938089832 2:128424294-128424316 GAGAATTCTTTAGAGGAGCAAGG + Intergenic
940341416 2:152585742-152585764 TAGAAATCTGAAGTGGGGACTGG - Intronic
940560879 2:155295130-155295152 TAGAATTATGATGAAAGGCAAGG + Intergenic
941052687 2:160752453-160752475 TAGAAATTTAGAGAGGGGCAAGG + Intergenic
941069549 2:160940517-160940539 TAGAAGTCTAAAGAGGCCCATGG + Intergenic
942402791 2:175621340-175621362 GGGATTTCTAAAGAGGGGCATGG + Intergenic
944611173 2:201410000-201410022 TAAAAACCTGAAGAGGGGCCGGG + Intronic
944865733 2:203859645-203859667 TGGAAGTATGAAGAGGGTCAGGG + Intergenic
945411961 2:209520423-209520445 TAGAATTCTAAAGAGGGAATAGG + Intronic
945554145 2:211258586-211258608 TAAAAATCTGAAGCTGGGCATGG + Intergenic
946114889 2:217452853-217452875 AAGAACTCTGAAGAAGGTCATGG + Intronic
947174985 2:227356756-227356778 CAGAAATCTGAAGAAGGGAAAGG + Intronic
1168758518 20:332575-332597 GAGAATTTTGAACAGTGGCAGGG - Intergenic
1172926915 20:38546147-38546169 TAAAATTCAGAAGAGTGGAAGGG + Intronic
1174449157 20:50609224-50609246 GAGACTTCTGCTGAGGGGCACGG - Intronic
1175871787 20:62212728-62212750 TAGAATTATGAAGAAGGCCCAGG + Intergenic
1177289428 21:19091602-19091624 TAGAAATTAGAAGAGAGGCATGG + Intergenic
1178471741 21:32899620-32899642 TAAAAGTTTGAAGAGGGACAAGG + Intergenic
1181077391 22:20390331-20390353 TAGACTTCTGAGGATGGGAAAGG - Intronic
1181440745 22:22934117-22934139 CAGAGCTCTGCAGAGGGGCAGGG + Intergenic
1182917172 22:34045035-34045057 TAGAATTCAGAAAATGGGCATGG - Intergenic
1183619040 22:38962082-38962104 TTAAATTCTGAAAAGGGACAGGG - Exonic
1183639998 22:39086995-39087017 TTAAATTCTGAAAAGGGACAGGG - Exonic
1183723703 22:39576856-39576878 CAGAAGTCGGCAGAGGGGCAAGG - Intronic
1184394268 22:44223474-44223496 CAGAATTCTGAACAGAGGGACGG - Intergenic
1185374438 22:50475441-50475463 TAGAAGTCAGAGGAGGCGCAGGG + Intergenic
951867838 3:27327245-27327267 TAGCATTCAGCAGAGTGGCATGG + Intronic
953965446 3:47301667-47301689 TTGATTTCTGAATGGGGGCAGGG - Intronic
955374176 3:58380513-58380535 TAAAATTCTGAAGAAAGGCCGGG + Intronic
955563687 3:60221765-60221787 CAGAATTCTGAAGAAGGAGAAGG - Intronic
955768238 3:62367181-62367203 TAAAATTCTGAAGAGGGATGGGG - Intergenic
955840307 3:63105821-63105843 TAGAATTCAGAAGAGTGTCTGGG - Intergenic
956368198 3:68529242-68529264 TAGAATTGTGAAGAAGGGCAGGG - Intronic
956710930 3:72038190-72038212 TAAAATTGTGAAGAAGGGAAAGG - Intergenic
957997654 3:87710725-87710747 TAGAGTCCTGAAGGGGTGCAGGG - Intergenic
959503005 3:107128233-107128255 TAGAAGTCTGAATAGGGCTACGG + Intergenic
961805970 3:129489541-129489563 AAGAATTCAGAGGAGGGGCCAGG + Intronic
961993885 3:131220603-131220625 TAGTTTTCTGAAGAGGGTAATGG - Intronic
963705819 3:148687168-148687190 TAGAATTGTGACTAGAGGCAGGG - Intergenic
964526198 3:157617176-157617198 CTGAATTCAGAAGATGGGCATGG - Intronic
965034472 3:163419962-163419984 TAGAATTGTGAAGTGCAGCAGGG + Intergenic
965798717 3:172468558-172468580 TAGAATTCTGAACAGTGACTAGG + Intergenic
967268594 3:187714231-187714253 TAGAACTGTGGAGAGAGGCAGGG - Intronic
969719889 4:8887826-8887848 TGGAATTGTGATGATGGGCAGGG - Intergenic
972260351 4:37401772-37401794 CAGAGGTCTGAAGATGGGCATGG - Intronic
974270609 4:59646612-59646634 TAGAATACCGAAGACTGGCAGGG - Intergenic
974994088 4:69131036-69131058 TAGAATTCTAAAAAGGGACCAGG - Intronic
975017204 4:69437038-69437060 TAGAATTCTAAAAAGGGACTGGG - Intergenic
975073833 4:70179437-70179459 TAAAATTTTAAAGAGGGGAAAGG - Intergenic
976337631 4:83908949-83908971 TAGAATTCTGCAGAGCAGGAAGG - Intergenic
980043024 4:127961522-127961544 AAGAATTCTGAGGCCGGGCACGG + Intronic
981152490 4:141395586-141395608 TAGAATGCAGAAGTGGGGAAAGG - Intergenic
981302676 4:143206985-143207007 GAAAATTCTTAAGAGGGGAAAGG - Intronic
982711551 4:158763028-158763050 TAAAATTCTGAAGAGAGGTCAGG + Intergenic
983228812 4:165109804-165109826 TAGAATTCTGAAAAAGGTAAGGG - Intronic
983683572 4:170381125-170381147 TACCATTCTGAACAGAGGCATGG - Intergenic
984579610 4:181496154-181496176 AAGAAATCTGAAGAGGCCCAAGG + Intergenic
986393652 5:7306685-7306707 TAGAATGCGGAAAAGGGGCGTGG + Intergenic
987011024 5:13765099-13765121 TAGAGTTGAGAAGAGGTGCATGG - Intronic
988393787 5:30670103-30670125 CAGAGTTCTGTAGAGGGACAGGG - Intergenic
988951812 5:36270134-36270156 GAGAATTCTGTAAAGTGGCAGGG - Intronic
990643545 5:57816511-57816533 CAGAATACTGAAGAAGGGGAGGG - Intergenic
992579389 5:78156079-78156101 TACAAATCTGAATAGGGGAAAGG - Intronic
992669313 5:79043025-79043047 TAGAGTTCTGAAAACAGGCAGGG + Intronic
994620147 5:102153560-102153582 TAGCATCATGCAGAGGGGCAAGG - Intergenic
996803972 5:127434103-127434125 TAGAATTCTTATGGGGGGAAAGG - Intronic
998871076 5:146552348-146552370 TCTTATTCTGAAAAGGGGCATGG + Intergenic
999747108 5:154600809-154600831 AGAAATTCTGAAGAGAGGCAGGG - Intergenic
1001317470 5:170654119-170654141 TTGAACCCTGAAGAAGGGCAAGG - Intronic
1001371964 5:171213643-171213665 CAGCATTCTGAAGAAGGGGAAGG - Exonic
1002978702 6:2112531-2112553 AAGGATTCTGAAGAGAGGCCTGG + Intronic
1003007105 6:2392327-2392349 TAGGACTCTCAAGAGGGACATGG - Intergenic
1006933404 6:37700886-37700908 TTCTATACTGAAGAGGGGCAAGG + Intergenic
1009649883 6:66461848-66461870 TAAAATTCTGAAGAGAGGTACGG + Intergenic
1013736763 6:113236586-113236608 TAGAATGCTGGAGAGGGAAATGG - Intergenic
1014004195 6:116398142-116398164 TAAAATTCTTAAGAGGGGAAAGG - Intronic
1015202931 6:130603027-130603049 AAGAATGCTGAAATGGGGCAGGG + Intergenic
1017692862 6:156984303-156984325 TAGAAATGTGAAGAGGTCCAAGG - Intronic
1018373429 6:163188814-163188836 TAGCATTCAGTAGAGGGGAAAGG + Intronic
1024605112 7:51016682-51016704 TGGAATCCTGCAGAGGGTCAAGG - Exonic
1025184723 7:56848819-56848841 TATGACTCTGAAGAAGGGCATGG - Intergenic
1025687207 7:63728143-63728165 TATGACTCTGAAGAAGGGCATGG + Intergenic
1028223870 7:88227246-88227268 GAGAATTCTGAAGACCTGCAGGG + Intergenic
1028314674 7:89385282-89385304 TAGAAATCTCAGGAGGGGTATGG - Intergenic
1028434377 7:90784982-90785004 TAGAATGCTGGAGTAGGGCAAGG - Intronic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1028766657 7:94567373-94567395 TAGAATTCTGAAGAAAGATAAGG - Intergenic
1028963581 7:96776754-96776776 TAGAAGCCTGAAGTGAGGCAAGG + Intergenic
1029957678 7:104656703-104656725 GAGAATTCTGGAGAGGTGGAAGG - Intronic
1031628696 7:124020514-124020536 TAGAATTTTCAAGAGGGAGAAGG - Intergenic
1031997524 7:128242359-128242381 TAGGATTCTGAGGTGGGCCATGG + Intronic
1032116963 7:129125945-129125967 TTTAATTCTGAAGAAGGGAAAGG - Intergenic
1032331803 7:130987352-130987374 TGGAATGCTGAAGAGGGGCAGGG + Intergenic
1032606925 7:133365527-133365549 AAGAATACTGAAGTGGGGCCTGG - Intronic
1034642609 7:152616372-152616394 CAGAATTCTGAACAGGGGCCGGG + Intergenic
1034748295 7:153544032-153544054 AAGAATTCTGGAAAGGGACACGG + Intergenic
1034979245 7:155465901-155465923 TATAACACTGAAAAGGGGCAAGG + Intergenic
1037271862 8:17138933-17138955 TAGAATTGAGAAAATGGGCAAGG + Intergenic
1037633311 8:20677692-20677714 TAGAATTCTGCAGAGGACAAAGG - Intergenic
1038066205 8:23966214-23966236 CAGAATTCAGAAGAGAGGCAGGG + Intergenic
1038323602 8:26552633-26552655 CAGAGTTCTGAGGAGGTGCAGGG + Intronic
1039869562 8:41534105-41534127 TAGAATTTTGATCAGGGGCCAGG + Intronic
1040464879 8:47685337-47685359 TAGAATTCAGTAAATGGGCAGGG + Intronic
1040479230 8:47808628-47808650 AAGAATTTTGAAGTTGGGCATGG - Intronic
1042031588 8:64482010-64482032 TTGCCTTCTGAAGAGGGGAAAGG - Intergenic
1044326115 8:90860181-90860203 GAGAATTCTCAGGAGGGTCATGG + Intronic
1046028982 8:108760632-108760654 GAGAATTTTGAAAAAGGGCAAGG - Intronic
1047170158 8:122484839-122484861 GGGAAATCTGAAGAGGGTCAGGG + Intergenic
1048846017 8:138604307-138604329 TAGAAGACTGTGGAGGGGCAAGG + Intronic
1048887083 8:138917274-138917296 TAGAAGCTGGAAGAGGGGCAAGG - Intergenic
1049119700 8:140723819-140723841 CAGAATCCTGAAGCGGGGAAAGG + Intronic
1051106015 9:13581139-13581161 TAGAGTTCTGCAGAGGAACATGG - Intergenic
1051218355 9:14822553-14822575 TAGCATTGTGAAGGTGGGCAGGG + Intronic
1051748766 9:20319834-20319856 GAAAATTCTAAAGATGGGCAAGG - Intergenic
1055249108 9:74281053-74281075 GAGAATTCTGAATGGGGGCAGGG + Intergenic
1055541858 9:77316902-77316924 TAGAGTTATGAAGAGGAGGAAGG - Intronic
1055771614 9:79722697-79722719 TAGAATTCTGAAGAGGGGCATGG - Intronic
1056776694 9:89518271-89518293 AGGAAATGTGAAGAGGGGCAGGG + Intergenic
1056930734 9:90874529-90874551 AGAAATTCTGAAGAGTGGCAGGG - Intronic
1059084438 9:111284824-111284846 TAGAATTCTGAGGAGGCACAAGG + Intergenic
1059351107 9:113665694-113665716 GTGAATGCTGGAGAGGGGCAGGG - Intergenic
1061676072 9:132216511-132216533 TAGGATTCTGCAGTGGGGCAGGG + Intronic
1061683858 9:132259124-132259146 CAGGGGTCTGAAGAGGGGCAGGG + Intergenic
1062723892 9:138060394-138060416 TAGAAACCAGCAGAGGGGCATGG + Intronic
1188316629 X:28682567-28682589 AAGAATTGTGAACAGGGGCCGGG - Intronic
1188734803 X:33699935-33699957 TGGAATTTTGAAGTGTGGCAGGG - Intergenic
1197124257 X:122925388-122925410 TGAAATTCTGGAGAGGGGCAGGG - Intergenic
1197144530 X:123156737-123156759 TAGAATTCTGAGGCTGGGCTTGG - Intergenic
1198577244 X:138024143-138024165 TACATTTCTGAAGTGTGGCATGG + Intergenic
1198777114 X:140191836-140191858 TAAACTTCTGAACTGGGGCAAGG - Intergenic
1201897376 Y:19006246-19006268 CAAAATACTGAAAAGGGGCAAGG + Intergenic