ID: 1055774311

View in Genome Browser
Species Human (GRCh38)
Location 9:79751650-79751672
Sequence AAGATCATTTTGGAACTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1484
Summary {0: 36, 1: 258, 2: 346, 3: 318, 4: 526}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055774311_1055774318 24 Left 1055774311 9:79751650-79751672 CCTTAAAGTTCCAAAATGATCTT 0: 36
1: 258
2: 346
3: 318
4: 526
Right 1055774318 9:79751697-79751719 GGTGCGTTGATGCAAGATGTGGG No data
1055774311_1055774313 2 Left 1055774311 9:79751650-79751672 CCTTAAAGTTCCAAAATGATCTT 0: 36
1: 258
2: 346
3: 318
4: 526
Right 1055774313 9:79751675-79751697 TTGACTCCATTCTCACATCCAGG No data
1055774311_1055774314 3 Left 1055774311 9:79751650-79751672 CCTTAAAGTTCCAAAATGATCTT 0: 36
1: 258
2: 346
3: 318
4: 526
Right 1055774314 9:79751676-79751698 TGACTCCATTCTCACATCCAGGG No data
1055774311_1055774317 23 Left 1055774311 9:79751650-79751672 CCTTAAAGTTCCAAAATGATCTT 0: 36
1: 258
2: 346
3: 318
4: 526
Right 1055774317 9:79751696-79751718 GGGTGCGTTGATGCAAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055774311 Original CRISPR AAGATCATTTTGGAACTTTA AGG (reversed) Intergenic
900799527 1:4728697-4728719 AAGGTCATTTTGCAACTTGCTGG + Intronic
900852361 1:5154022-5154044 GAGATCATTTTGGAATTTTAAGG + Intergenic
900903112 1:5530434-5530456 GAGATTATTTTGGAGCTTTAAGG + Intergenic
903662358 1:24985905-24985927 CACATCATTATGGAAATTTAAGG - Intergenic
903709496 1:25312160-25312182 AAGATCATTCTGAAGGTTTAAGG + Intronic
903717620 1:25380258-25380280 AAGATCATTCTGAAGGTTTAAGG - Intronic
905965630 1:42093070-42093092 GAGATTATTTTGGAGTTTTAAGG - Intergenic
906872914 1:49503662-49503684 AAGATCATTTTGGAGCTTTAAGG + Intronic
906883324 1:49617095-49617117 AAGATCATGTTGGGACTTCTGGG - Intronic
907320311 1:53597848-53597870 AATATCATTTTGACAATTTACGG - Intronic
907530431 1:55090258-55090280 ATGATCATTTTGGGACATTGGGG - Intronic
908176962 1:61565585-61565607 AAGATTATTTTGGAGCTTTAAGG - Intergenic
908715814 1:67068178-67068200 GAGATCATTTTGGAACTTTAAGG + Intergenic
908885254 1:68781251-68781273 GAGATCGTTTTGAAACTTTAAGG + Intergenic
909083771 1:71147335-71147357 AGGATCATTTGGGAACTTTAAGG + Intergenic
909129278 1:71714664-71714686 GAGATCATTTTGGAACTTTAAGG - Intronic
909257851 1:73447790-73447812 AAGATTATTTCGGAGCTTTAAGG - Intergenic
909266041 1:73559016-73559038 GAGATCATTTTGGAACTTTAAGG + Intergenic
909293271 1:73911966-73911988 CCGATCATTTTGAAACTTTAAGG - Intergenic
909409863 1:75337627-75337649 AAGATGATTTTGATAGTTTAAGG - Intronic
909457841 1:75870111-75870133 GAGATCATTTTGGAGCTTTTAGG + Intronic
909574628 1:77159654-77159676 GAGATCATTTTGGAACTTTAAGG + Intronic
909751438 1:79165994-79166016 GAGATAATTTTGGAACTTTAAGG + Intergenic
909813335 1:79959268-79959290 GAGATCATTTTGGAACTTTAAGG - Intergenic
910141440 1:84031349-84031371 GAGATAATTTTGGAACTTCAAGG - Intergenic
910568254 1:88670029-88670051 AAGATCATTTCTGAATTTTCTGG + Intergenic
911031468 1:93493464-93493486 AAGATCATTCTGGAGATTTATGG - Intronic
911278866 1:95898277-95898299 AATGTGATTTTTGAACTTTAAGG + Intergenic
911352475 1:96771526-96771548 AAAATCATTTTGTTAGTTTATGG + Intronic
911474784 1:98361587-98361609 GAGACCATTTGGTAACTTTAAGG - Intergenic
911511143 1:98808986-98809008 GAGATCATTTTGGAACTTTAAGG - Intergenic
911596301 1:99802124-99802146 AAGATCATGTAGGAACCTGAAGG - Intergenic
911780427 1:101869341-101869363 GTGATCATTTTGGAACTTTCTGG + Intronic
911788372 1:101979980-101980002 GAGATTATTTTGGAAGCTTAAGG + Intronic
911790983 1:102014916-102014938 GAGATCATTTTGAAACTTTAAGG + Intergenic
911817256 1:102368755-102368777 AAGGATATTTTGGAGCTTTAAGG + Intergenic
911969738 1:104416346-104416368 GAGATTATTTTGGAACTTTAAGG - Intergenic
912051994 1:105541508-105541530 GAGATCATTTTGGAACTTTAAGG - Intergenic
912055934 1:105597755-105597777 AAGATTATTTTGGAACTTTAAGG + Intergenic
912084089 1:105977313-105977335 GAGATCATTTTGGAACTTCAAGG + Intergenic
912096470 1:106150390-106150412 GAGATCATTTTGGATCTTTAAGG + Intergenic
912130620 1:106595405-106595427 AAGATCAGTTTGGAATTCAAAGG + Intergenic
912153069 1:106882831-106882853 GAGATCATTTTGGAACTTCAAGG - Intergenic
912154830 1:106904555-106904577 GAGATTATTTTGGAACTTTAAGG - Intergenic
912192022 1:107351968-107351990 GAGATTATTTTGAAGCTTTAAGG - Intronic
912297514 1:108484616-108484638 AAGATCCTTTTGGAAGTGGAAGG - Intergenic
912979609 1:114359084-114359106 AAAATCATTTTGGATGCTTATGG + Intergenic
913018635 1:114764528-114764550 GAAATCATTTTGGAACTTTAAGG + Intergenic
913094544 1:115503751-115503773 GAGATCCTTTTGGAACTTTAAGG + Intergenic
913208378 1:116563174-116563196 GAGATCATTTTGGAACTTTAAGG - Intronic
913289383 1:117258396-117258418 GAGATCATTTTGGAACTTTAAGG - Intergenic
913396549 1:118377985-118378007 GATATTATTTTGGAGCTTTAAGG + Intergenic
915787038 1:158624445-158624467 GAGATCATTTTGGAACTTTAAGG + Intronic
915811804 1:158920837-158920859 GTGATCATTTTGGAACTTTAAGG + Intergenic
915818176 1:158992438-158992460 TATAACATTTTGGAACTTTAAGG + Intergenic
915856060 1:159387460-159387482 GAAATCATTTTGGAACTTTATGG + Intergenic
915926474 1:160024329-160024351 CACATCATTGTGGAACTTAATGG + Intergenic
916186129 1:162135038-162135060 AAGATAATTTTTGAACTTGAAGG - Intronic
916228263 1:162512050-162512072 AAGATTATTTTGGCTATTTAGGG + Intronic
916400955 1:164448242-164448264 AAGATTATTTTGGAGCTTTAAGG - Intergenic
916417604 1:164607204-164607226 AAGATCAGATTTGTACTTTAAGG + Intronic
916477461 1:165183728-165183750 GATATCATTTTGGAACTTTAAGG + Intergenic
916736832 1:167615135-167615157 AAGATTGTTTTGGAAATTTGGGG + Intergenic
916987593 1:170208028-170208050 GAGATCATTTTGGAACTTTAAGG + Intergenic
917140064 1:171826832-171826854 GAGATCATTTTGGAACTTTAAGG - Intergenic
917214248 1:172661489-172661511 AAGATCATTTTGAAAATCTGTGG + Intronic
917228815 1:172814027-172814049 GAGATCATTTTGGAACTTTAAGG - Intergenic
917408700 1:174736325-174736347 AGGATTATTTAGGAGCTTTAAGG - Intronic
917414732 1:174797092-174797114 AAAATGATTTTGGAACTGTATGG - Intronic
918166113 1:181949156-181949178 GAGATCATTTTGGAACTTTAAGG + Intergenic
918230708 1:182528629-182528651 GAAATCATTTTGGAACTTTAAGG - Intronic
918621384 1:186609780-186609802 AAGGTCATTTGGGATGTTTAAGG + Intergenic
918700046 1:187597158-187597180 GAGATGATTTTGGAGCTTTAAGG - Intergenic
918718078 1:187817731-187817753 GACATCATTTTGGAACTTTAAGG - Intergenic
918841892 1:189551625-189551647 AAGATAATTTTGTAGGTTTATGG + Intergenic
918935555 1:190916302-190916324 AAGATCATTTTGGAAATATAAGG + Intergenic
919065954 1:192693212-192693234 GAGATCATTTTAGAACTTTAAGG - Intergenic
919102035 1:193106899-193106921 AAAACTATTTTGGAAATTTATGG + Intergenic
919124444 1:193378448-193378470 GAGATCATTTTGGAACTTAAAGG + Intergenic
919179157 1:194059218-194059240 GAGATTATTTTGAAGCTTTAAGG - Intergenic
919256191 1:195128272-195128294 GGAATCATTTTGGAACGTTAAGG - Intergenic
919273802 1:195385597-195385619 GAGATTATTTTGGAGCTTTAAGG + Intergenic
919277418 1:195439313-195439335 GAGATCATTTTGGAACTTTCAGG - Intergenic
919371860 1:196738571-196738593 GAGATAATCTTGGAAATTTAAGG - Intronic
919665640 1:200288816-200288838 AAGGGCATTTTGGAAATTTGTGG - Intergenic
920221738 1:204409095-204409117 AAAATCATTTTAAAACTCTATGG + Intronic
920325052 1:205156460-205156482 AAGATGATTTTGGAACTGCAGGG + Intronic
920594461 1:207255207-207255229 GAGGTCATTTTGGAACTTTAAGG - Intergenic
920900662 1:210107086-210107108 CAGATCATTTTGGAATTTTAAGG - Intronic
921282265 1:213578606-213578628 GAGATCATTTTGGAACTTTAAGG + Intergenic
921452312 1:215323595-215323617 GAGGTCATTTTGGAACTTTAAGG - Intergenic
921487627 1:215733743-215733765 GAGACTATTTTGGAGCTTTAAGG - Intronic
921531333 1:216285808-216285830 GAGATCATTTGGTAACTTTGAGG + Intronic
921763243 1:218940972-218940994 GAGATCATTTTGGAGCTTTAAGG + Intergenic
921880573 1:220250271-220250293 GAGATCATTTTGGAACTTTAAGG + Intronic
923179107 1:231498998-231499020 GAGATCATTTTGGAACTTTAAGG - Intergenic
923932900 1:238722523-238722545 GAGATCATTTTGGAGTTTTAAGG + Intergenic
924394830 1:243607398-243607420 GAGATCATTTTGGAACTTTAAGG + Intronic
924929487 1:248715740-248715762 TATGTCATTTTTGAACTTTAAGG - Intergenic
1063311726 10:4958541-4958563 AAGATGATTTTGCAGCTTTAAGG + Intronic
1063767698 10:9161036-9161058 GAGATTATTTTGGAGCTTTAAGG + Intergenic
1063767766 10:9161624-9161646 AAAATCATGTTGGAGGTTTAAGG - Intergenic
1063790233 10:9436706-9436728 AAGATCATTTTGGAAAGTAGTGG + Intergenic
1064045881 10:12014772-12014794 CAAATCATTATGGAAGTTTAAGG - Intronic
1064171451 10:13037420-13037442 AAGATTATTTTAGAAATTTGGGG - Intronic
1064761590 10:18626972-18626994 AAAATCAATTTGTAATTTTAAGG - Intronic
1065056619 10:21850702-21850724 AAGTTCATTTTGGCTATTTAGGG - Intronic
1065373386 10:25012552-25012574 GAGATCATTTTGGAACTTTAAGG + Intronic
1065641796 10:27790163-27790185 AAGAACATTTTTGTACTTCAAGG - Intergenic
1065671000 10:28117062-28117084 AAGATGGTTCTGGAACTATAGGG - Intronic
1066122316 10:32301460-32301482 AAGATCGTTTTGATATTTTAAGG - Intronic
1066506841 10:36054177-36054199 AAGATAAATTTGGAATTTTGAGG + Intergenic
1067573125 10:47386159-47386181 GAGGTCATTTTGGAACTTTAAGG - Intergenic
1067783030 10:49222918-49222940 AGGGTTATTTTGGGACTTTAAGG - Intergenic
1068070191 10:52185313-52185335 GAGACTATTTTGGATCTTTAAGG - Intronic
1068148168 10:53097903-53097925 GAGATCATTTTGGAGCTTTAAGG + Intergenic
1068221613 10:54052420-54052442 GAGGTCATTTTGAAACTTTAAGG + Intronic
1068232033 10:54180148-54180170 AAGATGATGTTGGTGCTTTAAGG + Intronic
1068264335 10:54626972-54626994 GAGATGATTTTGGAGCTTTAAGG + Intronic
1068312167 10:55292694-55292716 GAGATCATTTTCGAGCTTTAAGG - Intronic
1068369186 10:56091561-56091583 AGGATTATTTTAGAGCTTTAAGG + Intergenic
1068416746 10:56733645-56733667 GAGATCCTTTTGAAGCTTTAAGG - Intergenic
1068805704 10:61192166-61192188 AAGATCATTTTGGAACTTTAAGG - Intergenic
1069094971 10:64248868-64248890 GAGATCATTTTCTAACTTTAAGG - Intergenic
1069230260 10:66000091-66000113 AAGATAATTTTAAAACATTATGG + Intronic
1069239577 10:66123301-66123323 GAGATCATTTTGGAGCTTTAAGG - Intronic
1069339940 10:67398306-67398328 AAGAGCATTTTGGAACTTTAAGG + Intronic
1070444912 10:76488292-76488314 AAGGTCATTAGGGAAATTTAGGG - Intronic
1070491026 10:76976736-76976758 AAAATCCTTTTGGAATTTTCTGG + Intronic
1071243765 10:83740559-83740581 GGAATCATTTTGGAACATTAAGG - Intergenic
1071244973 10:83752436-83752458 GAGATCATTGTGGAACTTTAAGG - Intergenic
1072228619 10:93393661-93393683 AAAATCATGCTGGAACTATATGG - Intronic
1072289499 10:93950636-93950658 AAGTTCATTTTACAACTTAAAGG - Intronic
1072295955 10:94009751-94009773 AGGATTATATTGGAGCTTTAAGG - Intronic
1072339844 10:94436469-94436491 AAGATTTTTTAGGAACTTGAAGG - Intronic
1073628057 10:105119665-105119687 GAGATCATTTTGGAACTTTAAGG + Intronic
1073880363 10:107973736-107973758 AAAAAAATTTTGGAACTTTAAGG + Intergenic
1073922053 10:108470590-108470612 GAGATCATTTTGGAGCTTTACGG - Intergenic
1073964961 10:108978347-108978369 GAGATAATTTTGGAACTTTAAGG + Intergenic
1074474801 10:113761239-113761261 AAGATTATTTTGGATATTCAGGG + Intronic
1074622265 10:115138069-115138091 GAGATCATTTTGGAGCTTTAAGG - Intronic
1074838398 10:117323466-117323488 GGGATCATTTTGGAATTTTCAGG - Intronic
1075578891 10:123601632-123601654 AAAATCATTTTGGAAATTAGGGG - Intergenic
1075816730 10:125270427-125270449 AACATTCTTTTGGAACTTCAAGG - Intergenic
1076532049 10:131151436-131151458 GAGATCATTTTGGAAATTTAAGG - Intronic
1077510620 11:2959703-2959725 AAGATAATTTTGTAACTTGATGG - Intronic
1077736760 11:4799861-4799883 GCGATTATTTTGGAGCTTTAAGG - Intronic
1077754052 11:5006252-5006274 GTGATCATTTTGAAACTTTAAGG + Intergenic
1077845227 11:6015672-6015694 GAGATTATTCTGGAGCTTTAAGG + Intergenic
1077937165 11:6800626-6800648 GAGATTATTCTGGAACTTTAAGG - Intergenic
1077979489 11:7285849-7285871 AAGATCATTTTGGAACTTTAAGG - Intronic
1078308862 11:10218803-10218825 GGGATCATTTTGGAAATTTAAGG - Intronic
1078515039 11:12014647-12014669 GAGATCATTTTGGAACTTTAAGG + Intergenic
1078516114 11:12023793-12023815 GAGATCATTTTGGAAATTTAAGG + Intergenic
1078686683 11:13538562-13538584 GAGATTGTTTTGGAACTTTAAGG + Intergenic
1078834924 11:15017930-15017952 GAGATCATTTTGAAACTTTAAGG + Intronic
1078896607 11:15602452-15602474 AAGAATATTTTGGGACATTAAGG - Intergenic
1078959457 11:16248087-16248109 GAGGTCATTTTGGAACTTTAAGG - Intronic
1078978670 11:16506285-16506307 GAGATTATTTTGGAGCTTTAAGG + Intronic
1078994701 11:16685508-16685530 GAAATTATTTTGGAGCTTTAAGG - Intronic
1079214170 11:18491655-18491677 TAGATAATTATAGAACTTTAGGG + Intronic
1079511561 11:21216603-21216625 GACATCATTTTGGAACTTAAAGG + Intronic
1079521227 11:21328781-21328803 GACATCATTTTGAAACTTTAAGG + Intronic
1079719021 11:23787307-23787329 GAGATCATTTTGGAACTTTAAGG - Intergenic
1079804383 11:24911025-24911047 GAGATAATTTTGGAACTTTAAGG + Intronic
1079835056 11:25323549-25323571 GAGATCATTTTGGAACTTTAAGG + Intergenic
1079872957 11:25822708-25822730 TAGGTTATTTTGGAGCTTTATGG + Intergenic
1079880511 11:25921513-25921535 GACATTATTTTGGAGCTTTAAGG - Intergenic
1079949597 11:26784762-26784784 GAGATAATTTTGAAACTTTAAGG + Intergenic
1080215259 11:29832555-29832577 AAGATCATTTTGGAACTTTAAGG + Intergenic
1080245695 11:30177226-30177248 GAGATCATTTTGGAACTTTAAGG - Intergenic
1080359259 11:31493837-31493859 GAGATCATTTTGGAACATTAAGG - Intronic
1080372488 11:31667400-31667422 AACTTTATTTTGGAAGTTTATGG + Intronic
1080710536 11:34742997-34743019 AACATCACTTTGGAACTTCTTGG + Intergenic
1080715738 11:34798037-34798059 GAGATCATTTTGGAACTTTAAGG + Intergenic
1080958600 11:37130779-37130801 GAGATCATTCTGGAACTTTAAGG + Intergenic
1080978896 11:37376909-37376931 TAGATCATTTTGGAACTTTAAGG - Intergenic
1081101336 11:39006566-39006588 GAGATTATTTTGGAGCTTTAAGG - Intergenic
1081236614 11:40654435-40654457 GAGCTCATTTTGGAAGTTTAAGG + Intronic
1081349051 11:42026574-42026596 GAGATCATTTTGGAACTTTAAGG - Intergenic
1081386693 11:42480632-42480654 GAGATTATTTTGGAGCTTTAAGG + Intergenic
1081769104 11:45636307-45636329 GATGTCATTTTGGAACTTTAAGG + Intergenic
1081831267 11:46117924-46117946 AAAATCTTTCTGGAACTTTAAGG + Intronic
1082634022 11:55574942-55574964 TATATCATTTTTGGACTTTAGGG + Intergenic
1082729709 11:56780358-56780380 AAGAGGATTTGTGAACTTTAAGG - Intergenic
1082734210 11:56838502-56838524 AGGATCATTTTGGAACTTTAAGG - Intergenic
1082947927 11:58780170-58780192 GAGATCATTTTGGAACTTGAAGG - Intergenic
1083069556 11:59962599-59962621 GAAAACATTTTGGAACTATAGGG + Intergenic
1083085112 11:60134671-60134693 GAGATCATTTTGGAACTTTAAGG + Intergenic
1084132591 11:67148194-67148216 AGGATCATTTTTGAACTCTGGGG + Intronic
1085086513 11:73671515-73671537 GAGATTATTTTGGAGCTTTAAGG - Intergenic
1085851453 11:80124836-80124858 GAGATTATGTTGGATCTTTAAGG + Intergenic
1085861889 11:80244644-80244666 GAGATCATTTTGGAACTTTAAGG + Intergenic
1086309813 11:85522682-85522704 GAGATCACTGTGGAACTTTAAGG + Intronic
1086509630 11:87542867-87542889 GAGATCATTTTGGAACTTTAAGG - Intergenic
1086574236 11:88320403-88320425 AAGATTTTTTTCCAACTTTACGG - Intronic
1086828909 11:91534852-91534874 AAGATCATTTTGGAACTTTTAGG + Intergenic
1086836930 11:91636917-91636939 GAGAACATTTTGGAACTTTAAGG + Intergenic
1087385575 11:97464409-97464431 GAGATCATTTTGGAACTTTAAGG + Intergenic
1087478529 11:98668981-98669003 AATATCATTTTTGAAGTTTCAGG - Intergenic
1087493775 11:98863643-98863665 GAGATCATTTTGGAACTTGAAGG - Intergenic
1087515744 11:99158251-99158273 AAGATCATTTTGGAAGTCAGAGG - Intronic
1087675693 11:101158645-101158667 GAGATCATTTTGGAACTTTAAGG + Intergenic
1087793713 11:102433348-102433370 GAAATCATTTTGGAACTTTAAGG + Intronic
1087831660 11:102825806-102825828 GAGATCATTTTGTAACTTTAAGG - Intergenic
1087908206 11:103724143-103724165 GAGATCATTTTGGAACTTTAAGG - Intergenic
1088289100 11:108216893-108216915 TACATTATTTTGGAACTTTTGGG - Intronic
1088316180 11:108509019-108509041 ATGAACATTTAGGAAGTTTAAGG - Exonic
1088762761 11:112948140-112948162 GAGATCATTTTGGAACTTTAAGG - Intergenic
1088851004 11:113703243-113703265 GAGATCATTTTGGAACTTTAAGG + Intronic
1090100430 11:123790118-123790140 TACATCATTTTTGGACTTTAGGG + Intergenic
1090179732 11:124685751-124685773 AAGATCATTTTGGAACTTTAAGG + Intronic
1090316663 11:125797257-125797279 GAGATTGTTTTGGAACTTTAAGG - Intergenic
1091146263 11:133282839-133282861 GAGATTATATTGGATCTTTAAGG + Intronic
1091316565 11:134618000-134618022 AAGATTATCTTGGAGCTTTTAGG + Intergenic
1091452800 12:584214-584236 AAGGGCATTTTGGAACTACAGGG + Intronic
1091539760 12:1449028-1449050 GAGATCATTCTGGAACTTTAAGG + Intronic
1091811795 12:3405681-3405703 GAGATCATTTTGGAACTTTAAGG - Intronic
1092310249 12:7344399-7344421 CAGATTATTTTGGACATTTAAGG - Intergenic
1092667359 12:10817249-10817271 AAGATTGTTTTGGAAATTCAAGG - Intergenic
1093037984 12:14351386-14351408 GAGATCATTTTGGAACTTTAAGG - Intergenic
1093101252 12:15032232-15032254 AATACCATTTTTGGACTTTAGGG + Intergenic
1093192514 12:16091586-16091608 AAGATCATTTTGGAACTTTAAGG - Intergenic
1093313141 12:17616977-17616999 GAAATCATTTTGGAACTTTAAGG - Intergenic
1093570625 12:20662458-20662480 GAGATCAGTTTTGAACTTTAAGG + Intronic
1093570780 12:20663553-20663575 GAGATCATTTTTTAACTTTAAGG + Intronic
1093604901 12:21077892-21077914 GAGGTCATTTTGGAACAATAAGG - Intronic
1093624316 12:21327606-21327628 GAGATCATTTTGGAGCTTTAAGG + Intronic
1093629232 12:21387971-21387993 GAGATCATTTTGGAATGTTAAGG + Intronic
1093681700 12:22010072-22010094 GAGATCATTTTGGAACTTTATGG + Intergenic
1093766406 12:22968352-22968374 AAGATAATTTTGAAACTCTTTGG + Intergenic
1094253889 12:28399766-28399788 AAGATCATTATGGAATTTTAAGG - Intronic
1094282405 12:28754604-28754626 GAGATCATTTTGGAATTTTAAGG - Intergenic
1094397549 12:30024572-30024594 GAGATCATTTTGAATCTTTATGG - Intergenic
1094462378 12:30710660-30710682 AAGATTATCTTGGACCTTTCTGG - Intronic
1095268633 12:40189779-40189801 TATATCATTTTTGGACTTTAGGG + Intergenic
1095319736 12:40812700-40812722 AAGACCATTTTGTATATTTAGGG + Intronic
1095345812 12:41147852-41147874 GAGATCATTTTGGAACTTTAAGG - Intergenic
1095404350 12:41851424-41851446 AAGTTCATTTTTGTACCTTATGG - Intergenic
1095689214 12:45068723-45068745 GAGATCATTTTGAAACTTTAAGG - Intergenic
1095730446 12:45500971-45500993 CAGATCATTTAGGAACTTCTAGG + Intergenic
1095731230 12:45509083-45509105 AAGATCATTCTGAAACTTTAAGG - Intergenic
1095765104 12:45886257-45886279 GAGATCATTTTGGAACTTTAAGG - Intronic
1095836729 12:46647764-46647786 GAGATCATTTTGGAACTTTAAGG - Intergenic
1095919661 12:47516705-47516727 GAGGTCATTTTGGAACTTTAAGG - Intergenic
1096410368 12:51372900-51372922 GAAATCACTTTGGAACTTTAAGG + Intronic
1096969233 12:55652075-55652097 GAGATCATTTTGGAAATTTGAGG + Intergenic
1097142040 12:56909892-56909914 GAGATCATTTTGGCACTTTAAGG + Intergenic
1097377894 12:58860424-58860446 CAGATCATTCTGGAGCTTTAAGG - Intergenic
1097441274 12:59611816-59611838 GAAATCATTTTGGAACTTTAAGG - Intronic
1097476161 12:60058374-60058396 GAGATCATTTTGGAGCTTTAAGG + Intergenic
1097526223 12:60739754-60739776 GAGATCATTTTGGAACTTTAAGG - Intergenic
1097558088 12:61166049-61166071 GAGAAAATTTTGGAACTTTAAGG - Intergenic
1097599159 12:61670495-61670517 GAGATCTTTTTGGAACTTTATGG - Intergenic
1098713736 12:73801804-73801826 GAGATTATTTTGGAACTTTAAGG + Intergenic
1098761921 12:74435325-74435347 GAGATCATTCTGGAGCTTTAAGG + Intergenic
1098944326 12:76573428-76573450 GAGATCATTTTGGAACTTTAAGG - Intergenic
1099076244 12:78113042-78113064 GAGATAATTTTGAAACTTTAAGG - Intronic
1099492864 12:83307670-83307692 AAGATCATTTTGGGACTTTAAGG + Intergenic
1099536884 12:83856120-83856142 GAGACCATTTTGGAAATCTAAGG + Intergenic
1099565943 12:84246472-84246494 GAGATCATTTTGGAACTTTAAGG + Intergenic
1099607992 12:84829244-84829266 GAGATCATTTTGGAACTTTAAGG + Intergenic
1099838559 12:87937673-87937695 GAGATCATTTTGGGACTTTAAGG + Intergenic
1099899899 12:88695186-88695208 GAGATCATTTGGAAACTTTAAGG - Intergenic
1099932707 12:89092027-89092049 GATATCATTTTGTAACTTTAAGG + Intergenic
1099940866 12:89186752-89186774 AATAACATTCTGGAACATTAGGG - Intergenic
1099986673 12:89673660-89673682 AAGAACATTTTGCAACTATCAGG - Intronic
1100045955 12:90380857-90380879 AAGAGCAGTTTGGAAGTTAAAGG + Intergenic
1100051938 12:90459904-90459926 GAGATCATTTTGGAACTTCAAGG + Intergenic
1100060201 12:90566027-90566049 GAGATCATTTTGAAACTTTAAGG - Intergenic
1100097324 12:91056787-91056809 AAGAACATTTTAGCACTTTATGG + Intronic
1100657901 12:96667049-96667071 GTAATCATTTTGGAACTTTAAGG - Intronic
1100674808 12:96855591-96855613 GAGATCATTTTGGAACTTTAAGG - Intronic
1100747416 12:97661360-97661382 GAGATCATTTGGGAACTTTAAGG - Intergenic
1100791385 12:98134089-98134111 GACATCATTTTGGAACTTTAAGG + Intergenic
1100862766 12:98824043-98824065 AAGTGAAATTTGGAACTTTATGG - Intronic
1100898856 12:99215612-99215634 GAGATCATTTTTGAACTTTAAGG + Intronic
1100944564 12:99766424-99766446 AAGAACTTTTTGTAACCTTAGGG - Intronic
1101033764 12:100685200-100685222 GGGATCATTTTGGAACTTTAAGG - Intergenic
1101692829 12:107097260-107097282 GAGATCATTTTGGAACTTTAAGG + Intergenic
1101712527 12:107281841-107281863 GAGATCATTTTGGAACTTTAAGG - Intergenic
1103211778 12:119172469-119172491 AAGATCTTTTGGGGGCTTTAGGG - Intergenic
1103263576 12:119610136-119610158 GAGATTATTTTGAAACGTTAAGG + Intronic
1103357891 12:120335255-120335277 GAGATCATTTCAGAGCTTTAAGG - Intergenic
1104229730 12:126872664-126872686 AAGATAATTTAGGTAATTTAGGG + Intergenic
1104741994 12:131184472-131184494 GAGAGAATTTTGGAACTTTAAGG - Intergenic
1105608135 13:21944241-21944263 GAGATCATTTTGGAACCTCAAGG - Intergenic
1105644495 13:22302889-22302911 GAGATCATTTTGGAACTTTAAGG - Intergenic
1105665877 13:22555584-22555606 AAGTTCATTTTGTACCTTTCTGG - Intergenic
1106496952 13:30286891-30286913 GAGATAATTTTGGAAGTTTAAGG + Intronic
1106864504 13:33948731-33948753 GAAATCATTTTGAAACTTTAAGG + Intronic
1107962009 13:45567039-45567061 AAGATTATTTTGGAACTTTAGGG + Intronic
1108154654 13:47573073-47573095 AAGACTGTTTTGGAAGTTTAAGG + Intergenic
1108219337 13:48217003-48217025 AAGATCATTTTGGAACTTTAAGG + Intergenic
1108796110 13:54033052-54033074 GAGATCATTTTGAAACTTTAAGG - Intergenic
1108828851 13:54452305-54452327 GAGACCATTTTGGAACTTTAAGG - Intergenic
1108846326 13:54681696-54681718 AATATCATTTTGGTACTTTATGG + Intergenic
1108874278 13:55025606-55025628 GAGATCATTTTGAATCTTTAAGG + Intergenic
1108943228 13:55984674-55984696 AAGATAATTTTGAAAATTAAAGG - Intergenic
1109189467 13:59307725-59307747 GAGATCATTTTGGAACTTTAAGG - Intergenic
1109559366 13:64026357-64026379 AAGAGCAATTTGGAAATTAAAGG - Intergenic
1109718417 13:66246523-66246545 GAGATCATTTTGAAACTTTAAGG + Intergenic
1109876025 13:68405477-68405499 GAGATTATTTTGGAACTTTAAGG - Intergenic
1110007818 13:70294255-70294277 AAGATCATTTTGGAACTTTAAGG + Intergenic
1110062626 13:71062089-71062111 GAGATCATTTTAGAATTTTAAGG - Intergenic
1110074768 13:71226302-71226324 AAGATCACTTTGAAATTTGATGG + Intergenic
1110077505 13:71266985-71267007 AAAATCATTTTTTAAATTTAAGG - Intergenic
1110240944 13:73266107-73266129 AAAATCATGTTGTAACTCTAAGG - Intergenic
1110359727 13:74611183-74611205 GAGATCATTTTACAACCTTAAGG + Intergenic
1110404844 13:75138633-75138655 ATTGACATTTTGGAACTTTAAGG - Intergenic
1110411091 13:75204598-75204620 GAGATTATTTTGGAGCTTTAAGG - Intergenic
1110496436 13:76173793-76173815 GAGATCATTTTGGAACTTAAAGG - Intergenic
1110585656 13:77188325-77188347 AAGATGTTTTTGGAACTGTAAGG - Intronic
1110930144 13:81205350-81205372 GAAACCATTTTGGAACTTTAAGG + Intergenic
1110958755 13:81593018-81593040 AAAATCATTTTGGAAACTGAAGG - Intergenic
1111107862 13:83669673-83669695 GAGATCATTGGGGAACTTTAAGG + Intergenic
1111207869 13:85035702-85035724 GAGATTATTTTGGAGCTTTAAGG + Intergenic
1111218751 13:85178316-85178338 GAGATCATTTTGGACCTTTAAGG - Intergenic
1111339393 13:86863326-86863348 GACATCATTTTGGAATTTTAAGG + Intergenic
1111358837 13:87146702-87146724 AAGATCATTTTGAAACTTTGAGG + Intergenic
1111457777 13:88506909-88506931 AAGATTATTTCAGAACTTTAAGG + Intergenic
1111505411 13:89183354-89183376 AAGAACATTTTGGAACTTTAAGG - Intergenic
1111536256 13:89606384-89606406 GAGATCATTTTGGAGCTTTAAGG - Intergenic
1111543573 13:89700377-89700399 AACATCACTTTGGATCTTTGTGG + Intergenic
1111589655 13:90327775-90327797 AAAATTATTTATGAACTTTAAGG + Intergenic
1111751271 13:92334791-92334813 GAGGTCATTTTGGAACTTTAAGG - Intronic
1111821858 13:93224943-93224965 AAGATCATTTTATAAGTATAGGG + Intergenic
1112336642 13:98522215-98522237 AAGATCCTTCTGGAACTAGAGGG - Intronic
1112600532 13:100851116-100851138 AAAACTATTTTGGAACTTTCTGG + Intergenic
1112789464 13:102987478-102987500 GAGATCATTTTGGAACTTTAAGG - Intergenic
1112839969 13:103563989-103564011 GAGATCATTTTGAAACTTTAAGG - Intergenic
1112855763 13:103768065-103768087 GAGATCATTTTGGAACATTAAGG - Intergenic
1112864085 13:103872232-103872254 GAGATTATTTTGGAGCTTTAAGG - Intergenic
1112929042 13:104713018-104713040 AGGATTATTTTGGAGCTTTAGGG - Intergenic
1112954502 13:105041735-105041757 GAGATCATTTTGGAACTTTAAGG - Intergenic
1112996003 13:105575675-105575697 AAGATCATTTTGGAACTTTAAGG + Intergenic
1113029321 13:105976315-105976337 GAGACCATTTTGGAACTTTAAGG - Intergenic
1113133029 13:107059707-107059729 GAGATCTTTCTGGAACATTAAGG - Intergenic
1113247851 13:108418811-108418833 AAGAGCAATTTGCAACTCTAGGG + Intergenic
1113497468 13:110743297-110743319 GAGATCATTTTGGGACTTTAAGG - Intergenic
1114147376 14:19993495-19993517 GAGATGATTTTGAAACTTTAAGG - Intergenic
1114171148 14:20273443-20273465 GAGATTATTTTGGAACTTTAAGG + Intronic
1114431548 14:22666000-22666022 AAGATAATTTTGGAGAGTTAAGG - Intergenic
1114680414 14:24479552-24479574 GAGATCATTTTGGAACTTTAAGG - Intergenic
1114778611 14:25514379-25514401 GTGACCATTTTGGAACTTTAAGG - Intergenic
1114780382 14:25532627-25532649 GTGATCATTTTGGAACTTTAAGG - Intergenic
1114875535 14:26712975-26712997 AAAATCAGTTTGGCACTTTAAGG + Intergenic
1114991932 14:28298446-28298468 AAGATCATTTTGGAACTTTAAGG + Intergenic
1115089478 14:29556792-29556814 AAGATAACTTTGGACCTTTATGG - Intergenic
1115134869 14:30096069-30096091 GAGATCATTTTGTAACTTTGAGG + Intronic
1115340811 14:32291433-32291455 GAGATCATTTTGGAACTTTAAGG + Intergenic
1115929826 14:38478443-38478465 GAGATCATTTTGGAACTTTAAGG + Intergenic
1115932074 14:38508410-38508432 GATATTATTTTGAAACTTTAAGG - Intergenic
1115942957 14:38628992-38629014 AAGGTCATTTTAAAACTTTAAGG - Intergenic
1116024354 14:39497346-39497368 GAGATCATTTTGGATCTTTAAGG + Intergenic
1116080326 14:40162912-40162934 GAGATTGTTTTTGAACTTTAAGG + Intergenic
1116122489 14:40737851-40737873 GAGATTATTTTGGAACTTTAAGG + Intergenic
1116272247 14:42786671-42786693 CAAAACATTTTGTAACTTTAAGG + Intergenic
1116286846 14:42985365-42985387 GAGATCACATTGGAACTTTGAGG - Intergenic
1116303455 14:43217179-43217201 GAGATCATTTTGGAGCTTTAAGG - Intergenic
1116669955 14:47828621-47828643 GAGATCATTTTGGAAACTTAAGG - Intergenic
1116712384 14:48384308-48384330 AACATCATTTTAGAATATTATGG - Intergenic
1116714097 14:48406634-48406656 GAGATCATTTTGGAACTTTAAGG - Intergenic
1116762365 14:49030361-49030383 AAGATCATGAAGGAATTTTATGG + Intergenic
1116784199 14:49269405-49269427 GAGATCATTTTGGAACTTTAAGG + Intergenic
1117085557 14:52196800-52196822 GAGATCATTTTGGAACTTGAAGG + Intergenic
1117222298 14:53618232-53618254 AAGACCATTATGAAACCTTAAGG + Intergenic
1117396110 14:55312225-55312247 GAGATCATTTTGGAACTTTAAGG - Intronic
1117632793 14:57710693-57710715 GAGATCATTTTGGAACTTTAAGG + Intronic
1117908144 14:60611601-60611623 GAGATCATCTTGGAACTTTAAGG - Intergenic
1118069329 14:62228625-62228647 AAGAATATTTTGCAATTTTAAGG + Intergenic
1118119910 14:62829053-62829075 GAGATTATTTTTGAGCTTTAAGG - Intronic
1118402791 14:65395051-65395073 GAGATCATTTTGAAGCCTTAAGG - Intergenic
1118754458 14:68829564-68829586 AAGATCATTTTGGCTACTTAGGG - Intergenic
1118755347 14:68838985-68839007 AGGATCATTTGGGAACTTTGAGG + Intergenic
1119040456 14:71269808-71269830 GAGATCACTTTGGAACTTTAAGG + Intergenic
1119057847 14:71441409-71441431 AAGATCCTTTGGGAACTTCTGGG - Intronic
1119624715 14:76162699-76162721 AAGATCATTCAGGAACCATAAGG + Intronic
1119955881 14:78798345-78798367 GAGATCATTTTGGAACTTTAAGG - Intronic
1119963171 14:78882507-78882529 GAGATAGTTTTGGAACTTTAAGG + Intronic
1120074060 14:80135720-80135742 CAGATCATTTTTGAACTAGATGG - Intergenic
1120091057 14:80333911-80333933 GAGATCATTTTGGAGCTTTAAGG - Intronic
1120231276 14:81844023-81844045 GAGATTATTTTGGACCTTTAAGG - Intergenic
1120247850 14:82027332-82027354 GAAATTATTTTGGAGCTTTAAGG - Intergenic
1120270729 14:82309999-82310021 AAGATCATTTTGGAACTTTAAGG + Intergenic
1120279791 14:82424583-82424605 TAAAGCATTTGGGAACTTTAGGG - Intergenic
1120343018 14:83245567-83245589 AAGAATATTTTGGAGCTTTAAGG + Intergenic
1120388068 14:83870418-83870440 AAGAACATTTTGTAAGTTTAAGG - Intergenic
1120443367 14:84564799-84564821 AAGATTATTTTAGAACTTTAAGG + Intergenic
1120481365 14:85053750-85053772 GAGATCATTTTGGAAATTTAAGG - Intergenic
1120591020 14:86373187-86373209 GAGGTCATTTTGGAGCTTTAAGG + Intergenic
1120658968 14:87230356-87230378 GAGATCATTTTGGAACTTTAAGG - Intergenic
1120768605 14:88354761-88354783 GAGTGCATTTTGGAGCTTTAAGG - Intergenic
1120817975 14:88883223-88883245 AAGATTATTTAGGAGCTTTAAGG - Intergenic
1121672645 14:95724492-95724514 GAGATTATTTTGGAGCTTTAAGG + Intergenic
1121752603 14:96370053-96370075 AAGGAGATTTTGGAACTTGAAGG + Intronic
1202845957 14_GL000009v2_random:175572-175594 GACGGCATTTTGGAACTTTAAGG - Intergenic
1202915416 14_GL000194v1_random:166169-166191 GACGGCATTTTGGAACTTTAAGG - Intergenic
1202877321 14_KI270722v1_random:16876-16898 GATGACATTTTGGAACTTTAAGG + Intergenic
1123629036 15:22248085-22248107 GAGATCATTTTGGAACTTTAAGG + Intergenic
1123720874 15:23061224-23061246 AATATTATTTTGGAGCTTAAAGG - Intergenic
1123966708 15:25466839-25466861 AAGGTCATTTTGGGACGGTAAGG + Intergenic
1124171294 15:27376140-27376162 GAGATTATTTTGGAGCTTTAAGG - Intronic
1124253916 15:28125613-28125635 AAGAGCAATTTGGAATGTTAGGG - Intronic
1124556011 15:30726709-30726731 GAGATCATTTTGGAACTTTAAGG - Intronic
1124663247 15:31568296-31568318 GAGATTATTTTGGAACTTTAAGG + Intronic
1124675263 15:31679062-31679084 GAGATCATTTTGGAACTTTAAGG + Intronic
1125067447 15:35505811-35505833 AAAAGCATTTTGGAAATATAGGG + Intronic
1125137595 15:36362227-36362249 AAGCTCCTTTTTGACCTTTAGGG - Intergenic
1125230852 15:37453298-37453320 GAGTTCATTTTGGAACTTTTAGG + Intergenic
1126256154 15:46627731-46627753 GAGATCATTTTGGAACTTTAAGG + Intergenic
1126524616 15:49637770-49637792 AAGAACATTTTGACACTTTTTGG + Intronic
1126824999 15:52540043-52540065 GAGATCATTTTGGAACTTTAAGG - Intergenic
1126942379 15:53780822-53780844 GAGATCATTTTGGAACTTTAAGG - Intergenic
1127026741 15:54815221-54815243 GAGATTATTTTGGAGCTTTAAGG + Intergenic
1127051092 15:55084987-55085009 AAGATTATTTTGGAACTTTAAGG + Intergenic
1127591448 15:60428404-60428426 AAGATCTTTTTTGAAATTAAAGG - Intronic
1127791152 15:62399645-62399667 GAGAGCATTTTGGAACTTTAAGG + Intronic
1127926626 15:63550516-63550538 AAGATCAGTTTTTAAATTTAAGG + Intronic
1129900973 15:79149316-79149338 GAGATCATTTTGAAACTTTAAGG - Intergenic
1130210734 15:81919289-81919311 GAAGTCATTTTGGAACTTTAAGG + Intergenic
1130409260 15:83631121-83631143 GAGATCATTTTGGAACTTTGAGG - Intergenic
1130456309 15:84113377-84113399 AGGATCCTTTCTGAACTTTAAGG + Intergenic
1130791532 15:87160729-87160751 GAGATCATTTTGGAACTTTAAGG + Intergenic
1130797731 15:87228522-87228544 CAGATAATTTTGGGACTTTGGGG - Intergenic
1131470112 15:92689261-92689283 AGGATTATTTTGGAGCTTTAAGG + Intronic
1131637143 15:94248027-94248049 AAGATAATGTTGGATCCTTAGGG + Intronic
1131938552 15:97535016-97535038 AAAGTCTTTTTGAAACTTTAAGG + Intergenic
1132122048 15:99184478-99184500 GAGATCATTTTAGAACTATAAGG + Intronic
1134148021 16:11783197-11783219 ATAATCATTTTGGAAGTTTGTGG - Intronic
1136017574 16:27412450-27412472 AAGATTATTTTGGCTATTTAGGG + Intronic
1136523468 16:30812826-30812848 AAGGTCAGTTTGGAACATTAGGG + Intergenic
1136793568 16:32993686-32993708 AAGTTCATTTTCGAAGATTAAGG - Intergenic
1136872423 16:33819819-33819841 GAGATTATTTTGGAACTTTAAGG - Intergenic
1137060441 16:35788316-35788338 CAGATCCCTTTGGATCTTTACGG + Intergenic
1137902239 16:52281217-52281239 AAGCTCATTTTAGAAATATATGG + Intergenic
1137993773 16:53186279-53186301 GAGATCATTTTGGAACTTTAAGG + Intronic
1138744327 16:59345654-59345676 AAGAAGATTCTGGAAATTTATGG + Intergenic
1138769627 16:59648388-59648410 TGGATCATTTTGAAACTTCAAGG - Intergenic
1139033251 16:62911331-62911353 AACATTATTTTGGAACTTTAAGG - Intergenic
1139124311 16:64059067-64059089 GGTATCATTTTGTAACTTTAAGG - Intergenic
1139166159 16:64567104-64567126 GAGATGATTTTGGAACTTTAGGG + Intergenic
1140049011 16:71463127-71463149 GGGCTCATTTTGGAATTTTATGG - Intronic
1140146834 16:72319560-72319582 GAGATCATTTTGGAACTTTAAGG - Intergenic
1141273128 16:82558705-82558727 GAGATCATTTTGGAACTTCAAGG + Intergenic
1141317899 16:82979050-82979072 GGGATTATTTTTGAACTTTAAGG + Intronic
1141975039 16:87510173-87510195 GAGATCATTTTGGAACTTTTAGG - Intergenic
1203099749 16_KI270728v1_random:1296249-1296271 GAGATTATTTTGGAACTTTAAGG + Intergenic
1144160093 17:12549392-12549414 TAGAACATTTTGGGACTTGATGG - Intergenic
1144187226 17:12808056-12808078 GAAATCATTTTGGAACTTTAAGG - Intronic
1144225314 17:13139371-13139393 GTGGTCATTTTTGAACTTTAAGG + Intergenic
1144368751 17:14570085-14570107 GAGATTATTTTGGAGCCTTAAGG - Intergenic
1144399599 17:14883573-14883595 AGATTCATTTTGGAACTTTAAGG - Intergenic
1144538455 17:16114669-16114691 GAGATCATTTTGGAGCTTTAAGG - Intronic
1145365894 17:22266612-22266634 CAGATCCTTTTGGATCCTTAGGG - Intergenic
1145728198 17:27153312-27153334 CAGATCTTTTTGGACCCTTAGGG + Intergenic
1146342716 17:32035409-32035431 AAGATCTCTCTGGAATTTTACGG + Intronic
1146391851 17:32430116-32430138 GAGATTATTTTGGAGCTTTAAGG + Intergenic
1146451863 17:32981186-32981208 GAAACCATTTTGGAGCTTTAAGG - Intronic
1146571628 17:33958045-33958067 TAGATCATTTTGGAACTTTAAGG - Intronic
1147347538 17:39812021-39812043 AAGATCATTTGGGTCTTTTAAGG + Intronic
1147348837 17:39824184-39824206 GAGATCATTTTGGAACTTTAAGG + Intronic
1148800922 17:50225303-50225325 GAGATAATTTTGTAACTTTAAGG - Intergenic
1148910916 17:50942277-50942299 AAGATCATTCTGGATCTCTGTGG - Intergenic
1149112301 17:53048374-53048396 GACATCATTTTGGAACTTTAAGG - Intergenic
1149113579 17:53063658-53063680 GAGATCATTTTGTAACTTTAAGG + Intergenic
1149143220 17:53458546-53458568 GAGATCATTTTGCAACTTTAAGG + Intergenic
1149163862 17:53726602-53726624 GAGATCATTTTGGAACTTTAAGG - Intergenic
1149175666 17:53867569-53867591 CAGGGTATTTTGGAACTTTAAGG - Intergenic
1149216138 17:54357128-54357150 GAGATCATTTTGAAACTTGAAGG - Intergenic
1149386269 17:56146114-56146136 GGGATCATTCTGGAACTTTAAGG - Intronic
1149715953 17:58790548-58790570 ATAAACATTTTGGAACTTTGAGG + Intronic
1149853290 17:60054566-60054588 AGGACTATTTTGGAGCTTTAAGG + Intronic
1150858265 17:68774099-68774121 AAGATTATTTTGGCACTCTGTGG + Intergenic
1153138225 18:1941861-1941883 AAGATTGTTTTGTAGCTTTAAGG + Intergenic
1153348284 18:4051937-4051959 AAGATCATTTTGGAACTTTAAGG - Intronic
1154506510 18:15045741-15045763 GAGATAATTTTGGAAATTTAAGG - Intergenic
1155008005 18:21746482-21746504 AAGAAGATTTTGGGACTATATGG + Intronic
1155311858 18:24532077-24532099 ATGATTTTTTTGGAACTTTTGGG + Intergenic
1155413464 18:25571242-25571264 GAGATCATTTTGGAACTTCAAGG - Intergenic
1155431903 18:25768399-25768421 ACCATCATTTTGAGACTTTAAGG + Intergenic
1155516073 18:26624969-26624991 GAGATCATTTTGGAAATGTAAGG + Intronic
1155544694 18:26903276-26903298 GAGACCATTTTGGAACTTTAAGG - Intergenic
1155716622 18:28952199-28952221 GAGATCATTTTGTAACCTTAAGG - Intergenic
1156052288 18:32951945-32951967 GAGATAATTTTGAAACTTTAAGG - Intronic
1156169291 18:34463031-34463053 GAGATCGTTTTGGAACTTTAAGG - Intergenic
1156322407 18:36038797-36038819 AAGGTGATTTTGGAGCTTTAAGG + Intronic
1156614945 18:38772274-38772296 GAGATCATTTTGGAACTTTAAGG - Intergenic
1156784473 18:40893423-40893445 TAGATAATTTTGGAACTTTAAGG + Intergenic
1156943648 18:42800008-42800030 AGGAACATTCTGTAACTTTATGG - Intronic
1157008698 18:43620104-43620126 AAGTTCATTTAGAAACTTCATGG + Intergenic
1157848815 18:51029215-51029237 AACACCAGTTTGGAGCTTTAGGG + Intronic
1158020527 18:52836570-52836592 GAGATCATTCTGGAACCTTAAGG - Intronic
1158030395 18:52957181-52957203 ATGATCATTTATGATCTTTATGG + Intronic
1158124140 18:54083176-54083198 GTGAGCATTTTGGAACTTTAAGG + Intergenic
1158166626 18:54547739-54547761 GAGATCATTCTGGAGCTTTAAGG + Intergenic
1158185753 18:54769274-54769296 GAAATTATTTTGGAACTTTAAGG - Intronic
1158299173 18:56032967-56032989 GAGATCATTCTGTAACTTTAAGG - Intergenic
1158861371 18:61595184-61595206 AAAAACATTTTGGAACTAGATGG + Intergenic
1158943304 18:62426096-62426118 AAGCTCATTTTGTACCTTGAGGG - Intergenic
1159265448 18:66073352-66073374 GAGATCATTTTGAAACTTTAAGG - Intergenic
1159315975 18:66773503-66773525 AAGAACACTTTAAAACTTTAAGG + Intergenic
1159319580 18:66830052-66830074 GAGATTATTTTGGAGATTTAAGG - Intergenic
1159461129 18:68723611-68723633 GAGATCATTTTGGAACTTTAAGG - Intronic
1159652649 18:70996117-70996139 GAGATCATTTTGGAACTTTAAGG + Intergenic
1159695696 18:71553663-71553685 AAGAATATTTTGGAGCTTTGAGG + Intergenic
1159717709 18:71847420-71847442 GAGATCATTTTGGAACTTTAAGG + Intergenic
1159756400 18:72371116-72371138 GAGATCATTTTGGAACTTTAAGG + Intergenic
1159811882 18:73026206-73026228 GAGATCATTTTGGAACTTTAAGG + Intergenic
1159896055 18:73996944-73996966 TAGATCATTTTGGAACTTTAAGG + Intergenic
1160010093 18:75100829-75100851 AGGATTTTGTTGGAACTTTATGG - Intergenic
1160348861 18:78157256-78157278 AAGATCATTTAGGAACACTCAGG + Intergenic
1162002823 19:7758159-7758181 GAGATTACTCTGGAACTTTAAGG + Intergenic
1163230154 19:15996230-15996252 GAGTTCATTTTGGAACTTTAAGG + Intergenic
1202673359 1_KI270710v1_random:16066-16088 GATGGCATTTTGGAACTTTAAGG - Intergenic
924965994 2:77018-77040 GAGCTCATTTTGGAATTCTAAGG - Intergenic
924993709 2:338377-338399 GAGATCATTTTGGAACTTTAAGG + Intergenic
925245663 2:2380187-2380209 AAGATCATTTTGGAACTTTAAGG + Intergenic
925354477 2:3228279-3228301 GAGATCATTTTGGAACTTTAAGG + Intronic
925473948 2:4192253-4192275 AAGATCATTTTGGAACTTTAAGG - Intergenic
925805562 2:7644733-7644755 GAGATCATTTTGGAGTTTTAAGG - Intergenic
926280514 2:11442288-11442310 GAGATCATTTTGGAACTTTAAGG - Intergenic
926392020 2:12403257-12403279 GAGATCATTTTGGAATTTTAAGG + Intergenic
926456461 2:13073698-13073720 GAGATCATTTTGGAATAATAAGG - Intergenic
926526805 2:13991724-13991746 GAGATTATTTTGGAACTTTAAGG - Intergenic
926611842 2:14955195-14955217 GAGATCATTTCGGAACTTTAAGG - Intergenic
926836646 2:17031120-17031142 AAGATCATTTTGGAACTTTAAGG - Intergenic
926840231 2:17071603-17071625 AAGATCATTTTGGAACTTTAAGG + Intergenic
926869019 2:17391877-17391899 GAGATTATTTTGAAACTTTAAGG + Intergenic
927170805 2:20367801-20367823 GAGATCATTTTGGAACTTTAAGG - Intergenic
927242086 2:20928218-20928240 GAGATCATTTTGGAACTTTAAGG - Intergenic
927341836 2:21991959-21991981 GAAATCATTTCGGAACTTTAAGG - Intergenic
927400682 2:22706952-22706974 GAGACCTGTTTGGAACTTTAAGG - Intergenic
927660828 2:24991393-24991415 GAGATCATTTTGGAACTTTAAGG + Intergenic
928609990 2:32983188-32983210 GAGATCATTTTGGAACTTCAAGG + Intronic
928711192 2:34007796-34007818 AAGATCATTTTATAATTGTAAGG - Intergenic
929020260 2:37546282-37546304 GACATCATTTTGGGGCTTTAAGG - Intergenic
929382445 2:41368669-41368691 GAGATCATTTTGGAGCTTTATGG - Intergenic
929535357 2:42779845-42779867 TATGTCATTTTGGGACTTTAGGG - Intronic
929689107 2:44059906-44059928 GAGATTATTTTGCACCTTTAAGG - Intergenic
929770950 2:44891684-44891706 GAGATCATTTTGCAACTTTAAGG - Intergenic
930162898 2:48176441-48176463 AAGATTATTCTGGAACTTTAAGG - Intergenic
930230195 2:48835410-48835432 GAGATCATTTTGGAACTTGAAGG + Intergenic
930438539 2:51377555-51377577 GAGGTCATTTTGGAACTTTAAGG + Intergenic
930480664 2:51944264-51944286 GAGATCATTTTGGAACTTTAAGG + Intergenic
930481360 2:51952334-51952356 TAGATCATTTTGGAGCTTTCAGG - Intergenic
930512161 2:52358960-52358982 GAGATCCTTTTAGGACTTTAAGG + Intergenic
930544181 2:52746111-52746133 GAGATCATTTTGTAACTTTAAGG + Intergenic
930939693 2:56998682-56998704 GAGATCATTTTGGAACTTTAAGG - Intergenic
930960076 2:57251090-57251112 GAGATCATTTTGGAACTTTAAGG - Intergenic
931005372 2:57844895-57844917 AAGATCACATTGAAAATTTAGGG + Intergenic
931096185 2:58943330-58943352 AAGATCATTTTGTAACTTTGAGG + Intergenic
931494042 2:62783110-62783132 GAGATCATTTTGGAACTTTAAGG - Intronic
931967056 2:67546018-67546040 GAGATCATTTTGGAACTTTAAGG - Intergenic
932915769 2:75856263-75856285 AAGATCATTTTGAAACTTTAAGG + Intergenic
933445792 2:82378153-82378175 GAGATCATTTTGGAACTTGAAGG + Intergenic
933548079 2:83740281-83740303 AAGATCATTTTGGAACTTTAAGG - Intergenic
934017147 2:87899802-87899824 GAGATAATTTTGGGACTTTAAGG + Intergenic
934055057 2:88244406-88244428 GAGATCATTTTGGAGCTTTAAGG + Intergenic
934893294 2:98089024-98089046 GAGAGCACTTTGGCACTTTAAGG + Intronic
934940459 2:98497813-98497835 GAGATCATTTTGGAGCCTTAAGG + Intronic
935322973 2:101906640-101906662 GAGATCATTATGGAACTTTAAGG - Intergenic
935372790 2:102365354-102365376 GAGACTATTTTGGAACTTTAAGG - Intronic
935426934 2:102929383-102929405 GAGATTATTTTGGAAATTTGTGG + Intergenic
936001787 2:108839097-108839119 AAGATAATTTTGGAAAATTGTGG + Intronic
936470207 2:112791854-112791876 AAGATTATGTTGCAGCTTTAAGG + Intergenic
936671096 2:114657340-114657362 AAAATCATTTTGAAACATAATGG - Intronic
936713186 2:115156684-115156706 AAGATTATTTTGAATCATTAGGG + Intronic
936721236 2:115254769-115254791 GAGATAATTTTGGAACTTTAAGG - Intronic
936728875 2:115357400-115357422 GAGATCATTTTGGAACTTTAAGG - Intronic
936753778 2:115678880-115678902 CAGATCATTTTGGAACTTTAAGG + Intronic
936800237 2:116257533-116257555 GAGATCATTTTGGAATTTTAAGG - Intergenic
936800492 2:116259445-116259467 GAGATCATTTTGAAACTTTAAGG - Intergenic
936890632 2:117366020-117366042 GAGATCATTTTGGAGCTTTAAGG - Intergenic
937035066 2:118774298-118774320 AAGATATGTTTGTAACTTTATGG + Intergenic
937142372 2:119613071-119613093 GAGATAATTTTGGATCTTTAAGG - Intronic
937327964 2:121003376-121003398 AGGATTATTTTGGAGCTTTAAGG + Intergenic
937527580 2:122789293-122789315 GAGATTATGTTGGAGCTTTAAGG + Intergenic
937679964 2:124633411-124633433 GAGATTATTTTGGAGCTTTAAGG - Intronic
937761128 2:125604502-125604524 GAGATTATTTTGGGAGTTTAAGG + Intergenic
937889550 2:126926772-126926794 GAGATCATTTTGGAACTTTAAGG + Intergenic
937935627 2:127241801-127241823 AAGATCATTTTGCAACTTTAAGG - Intergenic
938234674 2:129696073-129696095 GAGACCATTTTGGAACTTTAAGG + Intergenic
938522506 2:132085256-132085278 AAGATAAATTTTGAACTTTGTGG + Intergenic
939175204 2:138740109-138740131 AAGATCACACTGGAACATTAGGG + Intronic
939331140 2:140762627-140762649 TGGATCATTTTCAAACTTTAAGG - Intronic
939364793 2:141217853-141217875 AAAATCTTTAAGGAACTTTAAGG + Intronic
939605960 2:144254858-144254880 AGAATCATTTTGCAACTTTAAGG + Intronic
939830482 2:147064799-147064821 GAGATTATTTTGAAACTTTAAGG + Intergenic
940143813 2:150524025-150524047 GAGATCATTTTGGAACTTTAAGG + Intronic
940403003 2:153268334-153268356 GTGATCATTTTGGAATTTTAAGG - Intergenic
940444870 2:153765367-153765389 TAGATCATTTTGGAACTTTAAGG + Intergenic
940484167 2:154275939-154275961 AAGATCACTCTGTAACCTTAAGG + Intronic
940505407 2:154547061-154547083 CAGATCATTTTGTAACTGTAAGG + Intergenic
940533044 2:154904496-154904518 GAGATCATTTTGGAACTTTAAGG - Intergenic
940578731 2:155549605-155549627 GAGATCATTTTGGAGCTTTAAGG - Intergenic
940783559 2:157958831-157958853 GAGATCATTTTGTAACTTTAAGG - Intronic
940989685 2:160085028-160085050 AAGAGGATTTTGGGACATTATGG - Intergenic
941227157 2:162864704-162864726 GAGATCATTTTGGAACTCTAAGG - Intergenic
941291391 2:163680103-163680125 AAAATGTTCTTGGAACTTTAGGG - Intronic
941307705 2:163891924-163891946 GAGATCATTTTGGAACTTTAAGG - Intergenic
941346313 2:164372966-164372988 GAGATCATTTTGGAACTTTAAGG + Intergenic
941445290 2:165592150-165592172 GAGATCATTTTGGAACTTTAAGG + Intronic
941513089 2:166437740-166437762 GAGATCATTTTGGAACTTTAAGG + Intronic
941525026 2:166596797-166596819 GAGATCATTTTGGAACTTTAAGG - Intergenic
941682563 2:168414737-168414759 GAGATCATTTTGGAACTTTAAGG - Intergenic
941877588 2:170450268-170450290 TACATCATTTTTGCACTTTAGGG + Intronic
941977809 2:171424544-171424566 GAGATCATTTTGGAACTTTAAGG + Intronic
942283454 2:174390300-174390322 GAGATCCTTTTGGCACTTTAAGG + Intronic
942380588 2:175386449-175386471 GAGATCATTTTGGAACTTTAAGG + Intergenic
942805728 2:179929580-179929602 GAGATCATTTTGGAGCTTAAAGG - Intergenic
942880653 2:180857325-180857347 GACATTATTTTGGAACTTTAAGG - Intergenic
943178966 2:184517739-184517761 AAGATCATTTTGGCTATTTGGGG + Intergenic
943231867 2:185264445-185264467 GAGATCATTTTGAAACTTTAAGG - Intergenic
943415022 2:187591071-187591093 GAGATCATTTGGAAACTTTAAGG - Intergenic
943448642 2:188020418-188020440 GAGATCATTTTGGAACCTTAAGG + Intergenic
943880615 2:193140090-193140112 AAGATCATTTTGGAACTTTAAGG - Intergenic
943936153 2:193919252-193919274 GAGATCATTTTGAAACTTTAAGG + Intergenic
944011386 2:194979157-194979179 GAGATCATTTTGGAACTTTAAGG - Intergenic
944338389 2:198565412-198565434 GAGATTATTTTGGAGCTTTAAGG + Intronic
944347070 2:198681979-198682001 AAGATTGTTTTGAAAATTTAGGG - Intergenic
944458121 2:199916692-199916714 GAGATCATTTTGGAACTTTAAGG - Intronic
944470986 2:200054145-200054167 GAGATCATCTAGAAACTTTATGG + Intergenic
944477702 2:200124565-200124587 GAGGTCATTTTGGAGCTTTAAGG - Intergenic
944872687 2:203930555-203930577 GAGATCATTTCAGAACTTTAAGG + Intergenic
944902793 2:204232665-204232687 AATATCATTTTAGGACTGTAAGG + Intergenic
945122031 2:206467454-206467476 AAGATTATTTTGTAACTTTAAGG - Intronic
945169012 2:206976382-206976404 AAGGGCATTTTGGAAGTTAAAGG + Intergenic
945265526 2:207887905-207887927 AAGGTTATATTGGAAATTTATGG + Intronic
945333208 2:208562724-208562746 GAGATCATTTTGGAATATTAAGG - Intronic
945726600 2:213477536-213477558 GAGATGATTTTGGAACTTTAAGG + Intronic
945768384 2:214008863-214008885 AAGATCATTTTTGCCCTTTCAGG + Intronic
945836383 2:214840161-214840183 AAGATTATTTTGGGTCTTTAAGG - Intergenic
945900735 2:215534531-215534553 GAGATGATTTTGGATCTTTAAGG + Intergenic
945931068 2:215855104-215855126 GAGATCATTTTGGAACTTTAAGG + Intergenic
946562149 2:220925856-220925878 GAGATCTTTTTGGATCTTTAAGG - Intergenic
946594368 2:221289798-221289820 TAGAGGATTCTGGAACTTTACGG + Intergenic
946874564 2:224114706-224114728 GAGACCATTTTGGAACTTTAGGG + Intergenic
947016460 2:225625838-225625860 TAGATCATTTTGGCAGTATAAGG + Intronic
947071890 2:226297424-226297446 AAGATTGTTTTGGAAATTTGAGG - Intergenic
947396765 2:229694589-229694611 GAGATCATTTTGGAACTTTAAGG + Intronic
947888620 2:233596031-233596053 GAGATCATTATGGAGCTTTAAGG + Intergenic
948016678 2:234696926-234696948 GAGATCATTTTGGAACTGTAAGG - Intergenic
948520254 2:238532001-238532023 GAGATTATTCTGGAACTTTAAGG + Intergenic
948878998 2:240846306-240846328 GAGATCATTCTGGAACTTTAAGG + Intergenic
1169320916 20:4632564-4632586 GAGATCATTTGGGAGCTTTAAGG + Intergenic
1169581010 20:7023105-7023127 GAGATCATTTTGGAATATTAAGG + Intergenic
1170116685 20:12867764-12867786 AAGATCATTTTGGAAATTTGGGG + Intergenic
1170337019 20:15281555-15281577 GAGATAATTTTGGAACTTTGAGG - Intronic
1170479895 20:16755295-16755317 AGGATTATTTTGGAGCTTTAAGG - Intronic
1170750278 20:19139171-19139193 GAGATCATTTTGGAATTTTAAGG - Intergenic
1171944532 20:31364901-31364923 GAGATTATTTTGGAACTTTAAGG - Intergenic
1173314447 20:41930914-41930936 GAGATAATTATGGAGCTTTAAGG - Intergenic
1173314764 20:41933075-41933097 AGGATAATTTTGGAGCTTTAAGG + Intergenic
1173323343 20:42009660-42009682 GAGATCATTTTGTAACTTTAAGG - Intergenic
1173323354 20:42009742-42009764 AAGATCATTTTGGAACTTTAAGG - Intergenic
1175013532 20:55764371-55764393 GAGATCATTTCAGAGCTTTAAGG - Intergenic
1176634767 21:9180813-9180835 GACGGCATTTTGGAACTTTAAGG - Intergenic
1176638601 21:9274308-9274330 GACGGCATTTTGGAACTTTAAGG + Intergenic
1176688409 21:9875487-9875509 GACATCATTTTGAAACTTTAAGG - Intergenic
1176791354 21:13323366-13323388 GAGATAATTTTGGAAATTTAAGG + Intergenic
1176877697 21:14149741-14149763 GGGATCATTTTGGAACTTTAGGG - Intronic
1176883829 21:14230178-14230200 CAGATCATTTTGGAACTTTAAGG + Intergenic
1177169506 21:17640151-17640173 AAGATTATTTTGGAGCTCTGAGG - Intergenic
1177359604 21:20050511-20050533 GAGATCATTTTGGAACTTTAAGG + Intergenic
1177394020 21:20510511-20510533 GATATTATTTTGGAACTTTAAGG - Intergenic
1177496087 21:21894383-21894405 GAGATCATTTTCGAACTTTAAGG - Intergenic
1177529096 21:22337308-22337330 GAGATCATGTTGGAACTTTAAGG + Intergenic
1177570207 21:22877236-22877258 GAGATCATTTTATAAATTTAAGG - Intergenic
1177589252 21:23140997-23141019 AATGTCATTTTTGGACTTTAGGG + Intergenic
1177676543 21:24308485-24308507 GAGATTATTTTGGAGTTTTAAGG - Intergenic
1177722747 21:24928522-24928544 GAGATTATTTTGAAGCTTTATGG + Intergenic
1177835668 21:26184176-26184198 GAAATTATTTTGGAACTTTAAGG - Intergenic
1177857836 21:26419662-26419684 GAGATCATTTTTCAACTTTAAGG - Intergenic
1177881617 21:26701990-26702012 AAGATCATTCTGGAACTTTAAGG - Intergenic
1177952127 21:27551885-27551907 GAGATCATTTTGGAACTTTAGGG - Intergenic
1177990440 21:28030006-28030028 GAGATAATTTTGGAACTTTAAGG - Intergenic
1178046116 21:28696395-28696417 GAGATTATTTTGGAACTTTAAGG - Intergenic
1178144034 21:29717515-29717537 GGGATCATTTTGGAACTTTTAGG + Intronic
1178180214 21:30151632-30151654 AAAATAATTTTGTATCTTTATGG + Intergenic
1178205161 21:30456317-30456339 AAGATTATTCTGGAACTTTAAGG - Intergenic
1178261795 21:31106743-31106765 GGGATCATTTTGGAACTTTAAGG - Intergenic
1178338686 21:31766666-31766688 GATATCATTTTGGAACTTTAAGG + Intergenic
1178681924 21:34679757-34679779 GAGATCATTTTGGAACTTGAAGG - Intronic
1180152880 21:45961007-45961029 GAGATTATTTTGGAATTTTAAGG - Intergenic
1180371904 22:12047151-12047173 GATGGCATTTTGGAACTTTAAGG + Intergenic
1180415368 22:12705971-12705993 GACGGCATTTTGGAACTTTAAGG + Intergenic
1180422643 22:12881815-12881837 GACGGCATTTTGGAACTTTAAGG + Intergenic
1181991882 22:26843273-26843295 AAGAACTTTTTGAAACTTGAAGG - Intergenic
1182815252 22:33156440-33156462 GAGATTATTTTTGAGCTTTAAGG + Intergenic
1182815717 22:33161636-33161658 AAGATCATTTTGGAACTTTAAGG - Intergenic
1184157691 22:42679142-42679164 AAGATCATTTTGGAACTTAAAGG + Intergenic
1184338949 22:43874956-43874978 AAGATCATTTTGGAACTTTAAGG + Intergenic
1184507296 22:44912022-44912044 GAGATAATTTTGGAGCTTTAAGG + Intronic
949156196 3:830004-830026 GAGATCATTTTGAAACTTTAAGG - Intergenic
949292526 3:2483195-2483217 GAGATCATTTTGGAGCTTTAAGG + Intronic
950375609 3:12569776-12569798 AACATCTGTTTGGAACTTTCAGG + Intronic
950755939 3:15172590-15172612 AAGGACATTTTGGAAATGTATGG + Intergenic
950853095 3:16081515-16081537 GAAATCATTTTGGAACTTTGAGG - Intergenic
950986538 3:17375919-17375941 AAAATCATTTTGGAAATGGAGGG - Intronic
951759624 3:26130830-26130852 AAGATCATTTTTGATATTTGGGG + Intergenic
952401283 3:32966328-32966350 GAGATCATTTTGGAACTTTAAGG + Intergenic
952504458 3:33995462-33995484 GAGATCATTTTGGAACTTTAAGG - Intergenic
952584703 3:34877301-34877323 GAGATCATTTTGGAAGTTTAAGG + Intergenic
952589421 3:34932709-34932731 GAGATCATTTTGGATCTTTAAGG + Intergenic
952608655 3:35181168-35181190 GAGATCATTTTGGAATTTTAAGG - Intergenic
952624819 3:35391786-35391808 GAGATCATTTTGGAACTTTAAGG - Intergenic
952671482 3:35974445-35974467 GAGATCATTTTGGAACTTTAAGG - Intergenic
952735464 3:36687116-36687138 AAGATTATTTTGGATATTTGGGG - Intergenic
953826847 3:46260558-46260580 GAGATCATTCTGGAGCTTTAAGG - Intronic
954720382 3:52556873-52556895 AAGAACATTATAGAACTCTATGG - Intronic
954740556 3:52746506-52746528 CAGATCATTTTGAAAGTTAAAGG - Intronic
954911885 3:54117496-54117518 GAGATCATTTTGGAACTTTAAGG + Intergenic
955312925 3:57908015-57908037 AAGATTACTTTGGTTCTTTAGGG + Intronic
955757928 3:62244865-62244887 AAGACCTTTTTAGAACTTTAAGG - Intronic
956922438 3:73944211-73944233 AAGATCATTTTGAAAATGTGGGG + Intergenic
956947017 3:74234659-74234681 GAGATCATTTTGGAACTTTAAGG - Intergenic
957012866 3:75028071-75028093 GAGATCATTTTGGAACTTTAAGG - Intergenic
957102255 3:75842805-75842827 GAGAGCGTTTTGGAACTTTAAGG - Intergenic
957160221 3:76601059-76601081 GAGATCATTATGGAGCTTTAAGG - Intronic
957170086 3:76727261-76727283 AAGATCATTTTAGAACTAACTGG - Intronic
957276440 3:78096305-78096327 AAGATCTTTTTTTAACTTAAAGG - Intergenic
957403733 3:79750143-79750165 GAGATCATTTTGGAGCTTTAAGG + Intronic
957471900 3:80668862-80668884 GAAATCATTCTGGAACTTTAAGG + Intergenic
957476754 3:80735151-80735173 AAGTTCATGTAGGAATTTTATGG - Intergenic
957477058 3:80739050-80739072 ATAATTATTTTGGAACTTCAAGG - Intergenic
957491863 3:80937705-80937727 AAGATCATTCTGGCATTGTAAGG - Intergenic
957666610 3:83239379-83239401 AAGACCTTTTTGGAACATTTGGG + Intergenic
957757590 3:84510319-84510341 GAGATCAGTTTGGAGCTTTAAGG + Intergenic
957920988 3:86748309-86748331 GAGATTATTTTGGAGCTTTAAGG + Intergenic
957956644 3:87196450-87196472 GAGATCATATTGGAACTTTAAGG + Intergenic
957978270 3:87474712-87474734 GAGATCATTTTGGAACTTTAAGG + Intergenic
957982351 3:87525972-87525994 GAAAACATTTGGGAACTTTATGG + Intergenic
958463323 3:94426744-94426766 GAGATCATTTTGGAACTTTAAGG + Intergenic
958537638 3:95424977-95424999 GAGATTATTTTGGAGATTTAAGG - Intergenic
958685359 3:97386461-97386483 TAGATCATTTTAGAACTTTGAGG - Intronic
958795808 3:98705012-98705034 AAGAGGATTTTGGAAATTGAGGG + Intergenic
958829171 3:99066887-99066909 AATATCATTTTAGGACTTTTAGG - Intergenic
958836306 3:99148702-99148724 GAGATCATTTTGTAAATTTAAGG + Intergenic
959142806 3:102506297-102506319 GAGATCATTTTGGAATTTTAAGG + Intergenic
959245584 3:103863289-103863311 AAAATTATTTTGGAGCTTTAAGG + Intergenic
959390175 3:105763025-105763047 GAAATCATTTTGGAGCTTTAAGG + Intronic
959606364 3:108245476-108245498 GAGATCATTTTGGAACTTTAAGG + Intergenic
959818471 3:110703896-110703918 GAGATCATTTTGGAACTTTAAGG - Intergenic
959862340 3:111230068-111230090 AGGATTACTTTGGAGCTTTAAGG + Intronic
960077156 3:113499740-113499762 AAGATCATTTTTGAAAATTTAGG - Intronic
960225008 3:115158329-115158351 GAGATCATTTTAAAACTTTAAGG + Intergenic
960255448 3:115506294-115506316 GAGATCATTTTGGAACTTTAAGG + Intergenic
960362938 3:116735778-116735800 GAGATCATTTTGGAAGTTTAAGG + Intronic
960473279 3:118093715-118093737 GAGATTATTTTGGAGTTTTATGG + Intergenic
960478249 3:118157929-118157951 GAGATCATTTTGTAACTTTAAGG - Intergenic
960499455 3:118419113-118419135 GAGACCATTTTGGAACTTTAAGG - Intergenic
960542029 3:118871794-118871816 GAGATTATTTCGGAGCTTTAAGG + Intergenic
960820494 3:121725361-121725383 AAGATTATTCTGGAATTTTAAGG + Intronic
961342542 3:126238164-126238186 AAGATCATTTTGAAACTTTAAGG - Intergenic
961503749 3:127356435-127356457 AAGATCATTTTGGAACTTTAAGG - Intergenic
961525397 3:127493769-127493791 AGGATTATTTTGGAGCTTTAAGG - Intergenic
962035098 3:131643307-131643329 GGGATCATTTTGGAACTTTAAGG + Intronic
962067066 3:131992357-131992379 GGGATCATTTCGGAATTTTAAGG + Intronic
962421522 3:135233361-135233383 GATATCATTTTGGAACTTTAAGG - Intronic
962509559 3:136084773-136084795 GAGATCATTTTGGAACTTTAAGG + Intronic
962619773 3:137166334-137166356 ATAATCATTTTGTAACCTTAGGG - Intergenic
962646349 3:137444706-137444728 AAGATCATTTTGGAACTTTAAGG - Intergenic
963297154 3:143558552-143558574 GAGATCATTTTGGAACTTTAAGG + Intronic
963386155 3:144597882-144597904 AAGATCATTTTGGACCTTTAAGG - Intergenic
963416328 3:145000279-145000301 GAGATTATTTTGGAGCTTTAAGG - Intergenic
963515731 3:146306101-146306123 GAAATCATTTTGAAACTTTCAGG - Intergenic
963517133 3:146322973-146322995 GAGATCATTTTTGAACTTTAAGG + Intergenic
963691615 3:148510685-148510707 AATATCATTTTGCAATTTAATGG + Intergenic
963777243 3:149451883-149451905 GAGATTATTTTGGAGCTTTAAGG - Intergenic
964090782 3:152873707-152873729 GAGATCACTTTGGAACTTTAAGG - Intergenic
964241570 3:154600986-154601008 GAGATTATTTTGGAGCTTTAAGG - Intergenic
964693335 3:159478543-159478565 AAGATCATTTTGGCCATTCAGGG + Intronic
964871998 3:161323257-161323279 AAATGCATTTTGGAACTATAAGG + Intergenic
965028661 3:163335314-163335336 GATATCACTTTGGAACTTTAAGG - Intergenic
965065346 3:163840873-163840895 GAGATCATTTTGGAACTTTAAGG - Intergenic
965108351 3:164387832-164387854 AAGATCATTTTGGAACTTTAGGG - Intergenic
965134070 3:164739700-164739722 GAGATTATTTTGTAGCTTTAAGG - Intergenic
965203571 3:165692443-165692465 GAGATAATTTTGGAGCTTTAAGG - Intergenic
965275414 3:166676686-166676708 TAGATCATTTTTGAACTTTAAGG - Intergenic
965305476 3:167058921-167058943 GAGATCATTTTGGAACTTTAAGG - Intergenic
965592404 3:170374377-170374399 AAGAGCATTTTGAAATGTTAAGG + Intronic
965865812 3:173203050-173203072 GAGATTATTTTGGAGCTTTAAGG - Intergenic
965929838 3:174029336-174029358 GAGATCATTTTGGAACCTTAAGG + Intronic
965931029 3:174043560-174043582 GAGATCATTCTGGAACCTTAAGG - Intronic
966273413 3:178135890-178135912 AAGATCAATTTTGAACTCCAGGG - Intergenic
966314738 3:178632995-178633017 GGGATCATTTTGTAACTTTAAGG - Intronic
966320282 3:178694667-178694689 GAGATCATTTTGGAACTTTAAGG - Intronic
966342037 3:178936015-178936037 AAGATTATTTTGGCTCTTTGGGG + Intergenic
966500714 3:180635601-180635623 GAGATTATTCTGGAGCTTTAAGG - Intronic
966550488 3:181199443-181199465 AAGATTATTTTGAAGCTTTAAGG - Intergenic
966560482 3:181314484-181314506 AATATCATATTTGAACTTTTAGG - Intergenic
966742057 3:183242950-183242972 GAGATTATTTTGGAACTTTAAGG + Intronic
967406260 3:189119167-189119189 GAGATAATTTTGGAACTTTAAGG + Intronic
967566638 3:190980416-190980438 GGGATCATTTTGGAACTTTAAGG + Intergenic
967582816 3:191179607-191179629 GAGATTGTTTTAGAACTTTAAGG + Intergenic
967634942 3:191790525-191790547 GAGATCATTTTGAGGCTTTAAGG - Intergenic
967776945 3:193394923-193394945 GAGATCATTTTGGAATTTTAAGG - Intergenic
967883579 3:194318297-194318319 AGGATCATTTTGGAGCTTTAAGG - Intergenic
1202748294 3_GL000221v1_random:130711-130733 GACGGCATTTTGGAACTTTAAGG - Intergenic
968590376 4:1455993-1456015 GAGATCATTTTGGAACTTTAAGG - Intergenic
968806643 4:2777416-2777438 TATGTCATTTTTGAACTTTAAGG + Intergenic
968865946 4:3211544-3211566 AACATCTTTTTCAAACTTTAGGG + Intronic
969121859 4:4916739-4916761 GAGATAATTTTGGAAATTTAAGG - Intergenic
969152031 4:5177785-5177807 GAGATCATTTTGGAACTTAAAGG - Intronic
969861948 4:10043615-10043637 AAGATCATTTTGGCTATTTGGGG - Intronic
969997134 4:11324536-11324558 GAGATTATTTTGGCGCTTTAAGG + Intergenic
970057734 4:11994271-11994293 GAGTTCATTTTGGAACTTTAAGG + Intergenic
970217560 4:13776052-13776074 GAGATCACTTTGGAACTTGAAGG - Intergenic
970302143 4:14692553-14692575 AATATCATTTTGGAACTTTAAGG + Intergenic
970351614 4:15207187-15207209 AAGTTCCTTTTGGAACTTTAAGG + Intergenic
970461334 4:16277564-16277586 GAGATTATTTTTGACCTTTAAGG + Intergenic
970678195 4:18476949-18476971 GAGATCATTTTGGAACTTTAAGG - Intergenic
971069897 4:23079750-23079772 GAGATCATTTTGGAACTTTAAGG - Intergenic
971111656 4:23592229-23592251 GAGATCATTTTGAAACTTTAAGG + Intergenic
971545402 4:27879642-27879664 GAGATTATTTTGGAGCTTGAAGG - Intergenic
971561460 4:28084036-28084058 GAGATAATTTTGGAACTTTAAGG - Intergenic
971601427 4:28596333-28596355 GAGATTATTTTGGAATTTTAAGG + Intergenic
971744908 4:30566838-30566860 GAGATCATTTTGGAAATTTAAGG + Intergenic
971845845 4:31916784-31916806 GAGATCATTTTGAAACTTTAAGG + Intergenic
971912278 4:32809914-32809936 GAGATAGTTTTGGAACTTTAAGG - Intergenic
971933521 4:33117541-33117563 AGGATAATTTTGGAGCTCTAAGG - Intergenic
972017314 4:34263114-34263136 GAGATCATTCTGGAATTCTAAGG - Intergenic
972049617 4:34712813-34712835 AAAATCAACTTGGAACTTTGTGG + Intergenic
972103037 4:35446108-35446130 GAGATTATTTTGGAAATTTAAGG + Intergenic
972434796 4:39023010-39023032 ACCATCATATTGGAATTTTAGGG - Intronic
972748930 4:41969339-41969361 GAGATCATTTTGGAACTTTAAGG + Intergenic
972799849 4:42462885-42462907 GAGATCATTTTGGAGCTTTAAGG + Intronic
972839532 4:42914373-42914395 AAGATCATTTTGGAACTTTAAGG + Intronic
972879572 4:43407145-43407167 GAAACCATTTTGGAACTTTAAGG + Intergenic
972890803 4:43553960-43553982 GAGATCATTTTGGAACTTTAAGG + Intergenic
973691466 4:53437556-53437578 AACATCATCTGGGAAATTTAGGG + Intronic
974101554 4:57422799-57422821 GAGATCATTCTGGAACTTTAAGG + Intergenic
974154633 4:58055399-58055421 AACATTATTTTGGTACTTTAAGG - Intergenic
974178741 4:58358757-58358779 GAGATCATCTTGGAACCTTAAGG + Intergenic
974214449 4:58827694-58827716 GAGATCATTTTGTAACTTTAAGG - Intergenic
974252601 4:59406304-59406326 ATGATAATTTTGTAATTTTATGG - Intergenic
974319981 4:60334463-60334485 GAGATCATTTTGGAGCTTTAAGG + Intergenic
974497484 4:62650969-62650991 GAGATCATTTTGGAGGTTTATGG - Intergenic
974614082 4:64258900-64258922 AAGATGATTTTGGAGCTTTGTGG + Intergenic
974628417 4:64453279-64453301 GAGATTATTTCAGAACTTTAAGG - Intergenic
974742189 4:66021455-66021477 GAGATAATTTTGGTACTTTAAGG - Intergenic
974763463 4:66308466-66308488 GAGATCATTTTGGAACTTTAAGG + Intergenic
974779205 4:66529304-66529326 GAGACCATTTTGAAACTATAAGG + Intergenic
974843471 4:67323806-67323828 AAGATCATTTTGGAGCTTTAAGG + Intergenic
974960353 4:68691907-68691929 AAGATCATTTTGTAATTTTAAGG - Intergenic
975040377 4:69738954-69738976 GAGATCATTTTGGAACTTTAAGG - Intronic
975307410 4:72865772-72865794 GAGATCATTTTTTAACCTTAAGG + Intergenic
975361243 4:73474740-73474762 AAGATCATTTTGGAACTTTAGGG - Intergenic
975403407 4:73962748-73962770 GAGATTATTTTGGAACTTCAAGG + Intergenic
975569242 4:75796321-75796343 AAGAGCATGATGGAACTTTCTGG - Intronic
975952402 4:79789406-79789428 GAGATTATTTTGGAACTTTAAGG + Intergenic
976000704 4:80370651-80370673 GAGATTATTTTGGAGCTTTAGGG - Intronic
976050808 4:81009644-81009666 GAGATAATTTGGGAACCTTATGG + Intergenic
976090226 4:81449495-81449517 AATATTATTTTGGAAATTTTTGG - Intronic
976259818 4:83135127-83135149 GAGATCATTTTGGAGCTTTAAGG - Intronic
976528672 4:86123702-86123724 AAGGTCATTATGGAACTTACTGG - Intronic
976581264 4:86739923-86739945 GAGATCATTTTGCAGCTTTAAGG - Intronic
976683891 4:87788880-87788902 GAGATAATTTTGGAACTTGCAGG + Intergenic
976726804 4:88222964-88222986 GAGATCATTTTGGAATGTTAAGG + Intronic
976748892 4:88433793-88433815 AAGAACAATTTGGAAGTTTATGG - Intronic
976763706 4:88577269-88577291 AACCTCAGTGTGGAACTTTAGGG - Intronic
976853487 4:89576234-89576256 GAGATTATTTTGAAGCTTTAAGG + Intergenic
976952538 4:90850545-90850567 GAGATCATTTTGGAACTTTAAGG + Intronic
977005990 4:91570087-91570109 GAGATCATTTTGCAGCTTTAAGG - Intronic
977014019 4:91669990-91670012 GAGATAATTTTAGAAATTTAAGG - Intergenic
977046150 4:92071210-92071232 AAGATCATTTTAGAGCTTTAAGG - Intergenic
977356339 4:95952131-95952153 AATATCATTTTGGAATTTTAAGG - Intergenic
977360700 4:96000501-96000523 AAAATCATTTTGGAACTTTAAGG - Intergenic
977550815 4:98441097-98441119 AAGATTGTTTTGGAGATTTAGGG + Intronic
977592922 4:98846764-98846786 TACATCATTTTTGGACTTTAGGG + Intergenic
977702437 4:100035771-100035793 GAGATCATTTTGGAACTTTAAGG - Intergenic
977952764 4:102993363-102993385 GAGATCATTATGGAACTTTAAGG - Intronic
977953451 4:103000629-103000651 GAGATTATTTTGGAGCTTTAAGG - Intronic
978043635 4:104099781-104099803 GAGATCATTTTGGAGCTTTAAGG + Intergenic
978145493 4:105366590-105366612 GAGATCATTTTGGAACTTTAAGG + Intergenic
978226308 4:106338944-106338966 GAGATCATTTTGGAACTTTGAGG + Intronic
978234862 4:106446402-106446424 GAGATCATTTTGGAACTTTAAGG - Intergenic
978252533 4:106650044-106650066 GAGATCATTTTGGAATTTTAAGG + Intergenic
978420493 4:108527626-108527648 AAAATCATGTTGGAGCTCTAGGG + Intergenic
978665953 4:111182565-111182587 GAGACCATTTTGGAACTTTAAGG - Intergenic
978809822 4:112837696-112837718 GAGGTTATTTTGGAGCTTTAAGG + Intronic
979027659 4:115597459-115597481 AAGACTATCTTGAAACTTTAAGG + Intergenic
979038449 4:115754965-115754987 GAGGTCATTTTGGAACTTTAAGG + Intergenic
979137572 4:117128427-117128449 GAAATCATTTTGGAACTTTAAGG + Intergenic
979411542 4:120385044-120385066 GAGATCATTTTGGGATTTTAAGG + Intergenic
979412470 4:120395815-120395837 GAGATCATTTTGGAACTTTAAGG - Intergenic
979699949 4:123656323-123656345 GAGGTCATTTTGGAATTTTAAGG - Intergenic
979775157 4:124581384-124581406 GAGATCACTTTGGAGCTTTAAGG - Intergenic
979906481 4:126300220-126300242 GAGATAATTTTGGAACTTTATGG - Intergenic
979984302 4:127295520-127295542 GAGATCATCGTGGAACTTTAAGG - Intergenic
980006924 4:127552824-127552846 GAGATCATTTTGGAACTTTAAGG + Intergenic
980351785 4:131693286-131693308 GACATCATTTTGAAACTTTAAGG - Intergenic
980386143 4:132089592-132089614 AGGATTATTTTGGAACTTCAAGG + Intergenic
980408162 4:132380935-132380957 GCGATCATTTTGGAACTCTAAGG - Intergenic
980579681 4:134732989-134733011 AAGATCATTTTGGAATTTTAAGG + Intergenic
980585977 4:134816764-134816786 GAAATCATTTTGAAACTTTAAGG - Intergenic
980650587 4:135710153-135710175 AAAATCATTTGGAAACTTGAAGG - Intergenic
980654000 4:135758996-135759018 GAGATCATTTTGGAACCTTAAGG - Intergenic
980654535 4:135765568-135765590 GAGATCATTTTGGAATTTTAAGG - Intergenic
980670115 4:135994415-135994437 GGGATCATTTTGGAACTTTAAGG - Intergenic
981184013 4:141779997-141780019 GAGATCATTTTGGAACTTTAAGG + Intergenic
981702296 4:147619934-147619956 CAGATCATGTTGGACCTTGATGG - Intronic
982301273 4:153881495-153881517 GAGATCATTTTGCAACTTTAAGG + Intergenic
982609158 4:157551651-157551673 AAGATCATATTGGAATTTTAAGG + Intergenic
982622426 4:157724494-157724516 GAAATGATTTTGGAACTTTAAGG + Intergenic
982822145 4:159954487-159954509 AAGATTATTTTGTAAGGTTAAGG - Intergenic
983006456 4:162490834-162490856 AAGATCATGTGGGAACTTTAAGG + Intergenic
983006817 4:162493809-162493831 GAAATCACGTTGGAACTTTAAGG + Intergenic
983048085 4:163010930-163010952 GAGATCATTTTGGAGGTTTAAGG - Intergenic
983322641 4:166213364-166213386 GAGATTATTTTGGAAATTTAAGG - Intergenic
983378266 4:166957694-166957716 GAGATTATTTTGAAGCTTTAAGG + Intronic
983644954 4:169980343-169980365 AAGAACATTTTTGAGCTTAATGG + Intergenic
983669145 4:170215667-170215689 GAGATCATTTTGGAACGTTAAGG + Intergenic
983863263 4:172734522-172734544 GAGATTATTTTGGAGCTTTGAGG - Intronic
983863394 4:172735313-172735335 GAGATTATTTTGGAACTTTGAGG + Intronic
983889563 4:173016499-173016521 GAGATCATTTTGGAACTTTAAGG + Intronic
984047153 4:174815163-174815185 GAGATCATCTTGGAGCTTTGAGG - Intronic
984219403 4:176955080-176955102 GAGATCATTTTGGAACTTTTAGG - Intergenic
984291761 4:177805040-177805062 AAGATCATTATTGTAATTTAGGG - Intronic
984318496 4:178160894-178160916 GAGAACATTCTGAAACTTTAAGG - Intergenic
985112636 4:186561848-186561870 GAGATCATTTTGTCACTGTAAGG + Intergenic
985386442 4:189452756-189452778 GAGATTATTTTGGAACATTATGG + Intergenic
985394383 4:189526078-189526100 GAGATTATTTTGGAACTTTAAGG + Intergenic
1202753488 4_GL000008v2_random:32719-32741 GATGGCATTTTGGAACTTTAAGG + Intergenic
985474192 5:68968-68990 GAGATAATTTTGGAACTTTAAGG + Intergenic
985582992 5:709582-709604 GAGATTATTTTGGAACTTTAAGG + Intergenic
985596670 5:794833-794855 GAGATTATTTTGGAACTTTAAGG + Intergenic
985617702 5:933974-933996 GAGATCACTTTGGAGCTTTATGG - Intergenic
986129002 5:4910025-4910047 GAGATCACTTTGGAACTTGGAGG - Intergenic
986138499 5:5006281-5006303 GAAATCATTTGGGAACTTTAAGG + Intergenic
986194694 5:5527244-5527266 TAGATCATTTTGGAGCTTTAAGG + Intergenic
986360781 5:6975900-6975922 GAGATTATTTTGGAGCTTTAAGG + Intergenic
986500307 5:8391514-8391536 AATATCTTTCTGGAATTTTAGGG - Intergenic
986507731 5:8470350-8470372 GAGATCATTTTGGAACATTAAGG - Intergenic
986533454 5:8762226-8762248 GAGATTATTTTGGAACTTTAAGG + Intergenic
986780815 5:11064068-11064090 AAGATGACTTTAGAACTTCAGGG + Intronic
986798171 5:11232468-11232490 GAGATCATTTTGGAACTTTAAGG + Intronic
987003851 5:13689052-13689074 GAGATTGTTTTGAAACTTTAAGG + Intergenic
987455326 5:18138127-18138149 GAGATTATTTTGGAACTTTAAGG - Intergenic
987460109 5:18198561-18198583 AGGATTATTTTGGAGCTTGAAGG + Intergenic
987538124 5:19215044-19215066 ATCTTCATTGTGGAACTTTATGG + Intergenic
987541500 5:19261526-19261548 GAAATCATTTTGAAACTTTAAGG + Intergenic
987543390 5:19283709-19283731 GAGATTAATTTGGAGCTTTAAGG - Intergenic
987560406 5:19512229-19512251 AAGATCATTTCAAAGCTTTAAGG - Intronic
987642301 5:20628475-20628497 GGGATCGTTTTGGAAGTTTAAGG - Intergenic
987675108 5:21063921-21063943 AAGATCATTTTGAAACTTTAAGG + Intergenic
987700256 5:21389313-21389335 AAACCCATTTTAGAACTTTAAGG - Intergenic
987754093 5:22077779-22077801 AATATCTTATTGCAACTTTATGG - Intronic
987918500 5:24248331-24248353 GAGATCATTTTGCAACTTTAAGG - Intergenic
988080733 5:26411215-26411237 GAGATTATTTTAAAACTTTAAGG + Intergenic
988138089 5:27200941-27200963 AAGATCATGTTAGAAGTTTAAGG - Intergenic
988221171 5:28348823-28348845 AAGATCATTTCAGAGCTTTACGG - Intergenic
988396372 5:30701510-30701532 GAGGTCATTTCAGAACTTTAAGG + Intergenic
988668868 5:33359932-33359954 GAGATTATTTTGGAGCATTAAGG - Intergenic
988911144 5:35845346-35845368 GAGATCATTTGGGAACTTTAAGG - Intergenic
988928024 5:36008873-36008895 GAGATTATTTTGGAGCTTTAAGG - Intergenic
989032744 5:37136307-37136329 AAGATCATTTTGGAACTTTAAGG - Intronic
989132721 5:38123894-38123916 GAGATCATTTTGGAACTTCAAGG - Intergenic
989133432 5:38129900-38129922 AGGATCATTTGGGAAATTTCAGG + Intergenic
989218238 5:38927027-38927049 GAGATCATTTTGGAACTTTAAGG - Intronic
989224628 5:39011682-39011704 GAGATCATTTTGGAACTTGAAGG + Intronic
989289595 5:39747858-39747880 ATAATTATTTTGGAACTCTAGGG + Intergenic
989523587 5:42427867-42427889 GAGTTCATTTCAGAACTTTAAGG - Intronic
989680516 5:44023219-44023241 AAGATTATTCTGAAGCTTTAAGG + Intergenic
989695937 5:44200714-44200736 ACGATCATTTTGGAACTTTAAGG + Intergenic
989726781 5:44596972-44596994 AAGATCATTTTGGAACTTTAAGG - Intergenic
990041223 5:51380937-51380959 ATGATCAATTTAGAACTTCAAGG + Intergenic
990083459 5:51945258-51945280 GAGATCATTTTGGAACTTCAAGG + Intergenic
990484325 5:56243051-56243073 AAGATCATTTTGGAAATTTAAGG + Intergenic
990701004 5:58475034-58475056 GAGATCATTTTGGAACTTTAAGG - Intergenic
990941391 5:61206206-61206228 GAGATCATTTTGCAGCTTCAAGG - Intergenic
991204898 5:64039065-64039087 AAGATTATTTTGGAGCTTTAAGG + Intergenic
991402707 5:66271185-66271207 AGTATGCTTTTGGAACTTTAAGG + Intergenic
991940745 5:71849975-71849997 GAGATCATTTGGGAACTTTAAGG - Intergenic
992082125 5:73243877-73243899 AATATTATTTTGGAAATTTTGGG + Intergenic
992375599 5:76185119-76185141 AAAATCATTTTGGAATGTTAAGG - Intronic
993066994 5:83113240-83113262 GAGATCATTTTGGAACTTTAAGG - Intronic
993164178 5:84330987-84331009 AAGATCATTTTGGAACTTTAAGG + Intronic
993257818 5:85616407-85616429 GAGATCATTTTGCAACTTTAAGG - Intergenic
993456241 5:88130811-88130833 GAGATGATTTTGGAGCTTTAAGG - Intergenic
993590551 5:89790282-89790304 GAGATCATTTTGGAAATGTAAGG - Intergenic
993630527 5:90280884-90280906 AACATCATTTTGGAAGATGAAGG + Intergenic
993703960 5:91148900-91148922 AAGATCATTTTTTGACTTTAAGG + Intronic
993711495 5:91229979-91230001 GAGATCATTTTGGAACTTTAAGG - Intergenic
993761236 5:91799897-91799919 GAGATCATTTTGGAACTTTAAGG - Intergenic
993792482 5:92224187-92224209 GAGATCATTTTGGAACTTTAAGG - Intergenic
993967106 5:94372047-94372069 GAGATCATTTTGGAATTTTAAGG - Intronic
994603238 5:101934870-101934892 GAAATCATTTTTGTACTTTATGG - Intergenic
994764608 5:103900534-103900556 GAGATCGTTTTGGAACTTTAAGG + Intergenic
994808324 5:104479793-104479815 GAGATCATTTTGGTACTTTAAGG + Intergenic
994925693 5:106114733-106114755 GGGATTATTTTGGAGCTTTAAGG + Intergenic
995009454 5:107240917-107240939 GAGATCATTTTGGAACTTTAAGG + Intergenic
995055474 5:107754207-107754229 GAGATCATTTCAGAACTTTAAGG + Intergenic
995389818 5:111627557-111627579 GAGATCATTTTGGAACTTTAAGG + Intergenic
995391051 5:111640435-111640457 GAGATCATTTTGGAACTTTAGGG + Intergenic
995393093 5:111660776-111660798 GAGATCATTTTGGAACTTTAAGG - Intergenic
995429174 5:112055202-112055224 AAGATCATCTTGAAATTTTAAGG + Intergenic
995590914 5:113698996-113699018 GAGATCATTTTGGAACTTTAAGG - Intergenic
995630459 5:114126948-114126970 GAGATCATTTTGGAACTTTAAGG - Intergenic
995700053 5:114925327-114925349 AAGATTGTTTTGGCAATTTATGG - Intergenic
995702895 5:114955646-114955668 GAGATCATTTTAGAGCTTTAAGG + Intergenic
995828559 5:116329084-116329106 GAGATCATTTTGAAAATTTAAGG - Intronic
995872436 5:116756960-116756982 GAGATTATTTTGGAACTTTAAGG + Intergenic
995925612 5:117369794-117369816 GAGATCATTTTGGAACTTTAAGG + Intergenic
996122833 5:119691056-119691078 AAGATCATTTTGGAACTTTAAGG - Intergenic
996255948 5:121403087-121403109 GATATCATTTTGGATTTTTAAGG + Intergenic
996265649 5:121535984-121536006 TAGATCACTTTGGTTCTTTATGG - Intergenic
996468067 5:123826175-123826197 GAGATAATTTTGGAACTTTCAGG + Intergenic
996774674 5:127120789-127120811 GAGATCATTTTGGAACTTTAAGG - Intergenic
997021973 5:130013100-130013122 GAAATCATTTTAGAACTCTAAGG - Intronic
997088259 5:130826614-130826636 GAGATCATTTTGGAACTTTAAGG - Intergenic
997102007 5:130980134-130980156 GAGATCATTTTGGAACTTTAAGG - Intergenic
997651283 5:135523315-135523337 GAGATCATTTTGGAGTTTTATGG - Intergenic
998753586 5:145351893-145351915 GAGATCATTTTGGAACTTTAAGG - Intergenic
998756877 5:145390942-145390964 GAGATTATTTTGGGACTTTAAGG - Intergenic
998758978 5:145411435-145411457 AAAATTATTATGGAACTTTAAGG - Intergenic
998980619 5:147698143-147698165 GAGATCATTTGGAAACTTTAGGG + Intronic
999922587 5:156338111-156338133 AAGATCATTAGGAAACTTGATGG + Intronic
1000262320 5:159599933-159599955 AATATTATTTTGGAGCTTTAAGG - Intergenic
1000470843 5:161640119-161640141 AAGATCATTTTGGAACTTTAAGG + Intronic
1000526784 5:162368704-162368726 GAGATCATTTTGGAACTTTAAGG - Intergenic
1000581105 5:163036018-163036040 GAGATCACTTCGGAACTTTAAGG + Intergenic
1000589399 5:163140406-163140428 AAGATATTTCTAGAACTTTAAGG + Intergenic
1000609683 5:163360311-163360333 GAGATCACTTTGGAACTTTAAGG + Intergenic
1000612437 5:163388705-163388727 AAGATCATTTTGGGACTTTAAGG - Intergenic
1000787995 5:165570284-165570306 GAGATTATTTTGGAGCTTTAAGG - Intergenic
1001836511 5:174837069-174837091 GAGATCATTTTGGAACTTGAAGG + Intergenic
1001943909 5:175761653-175761675 GAGATTATTTTGGAGCTTTAAGG + Intergenic
1002869902 6:1157253-1157275 GAGATCATTTTGGAACTCTAAGG + Intergenic
1002958164 6:1888899-1888921 GAGATTATTTTGGAACATTAAGG - Intronic
1003993711 6:11515895-11515917 AAGAACATTTAGGAACTGTGAGG - Intergenic
1004657618 6:17679544-17679566 AAGATTATTTTGGCATTTTGAGG - Intronic
1005520225 6:26594729-26594751 AAGAACATTTTAGAACATTTTGG + Intergenic
1005983067 6:30852157-30852179 GGGAGCATTTTGGAACGTTAAGG + Intergenic
1006755820 6:36414419-36414441 AAGATCATATAGGAAGCTTATGG + Intronic
1007990954 6:46255503-46255525 AAGATAATTTTGTAAGTTTAAGG + Intronic
1008298747 6:49808402-49808424 GAAATCATTTTGAAACTTTAAGG - Intergenic
1008337425 6:50324288-50324310 GAGATCATTTTGAAACTTTAAGG - Intergenic
1009026899 6:58010858-58010880 AGGTCCATTTTGGAACTTAAAGG + Intergenic
1009051656 6:58283293-58283315 GAGATCCTTTTGGAACTTTAAGG + Intergenic
1009242513 6:61199201-61199223 GAGATCATTTTGGAACTTTAAGG + Intergenic
1009501466 6:64419668-64419690 GAGATCATTTCAGAACTTTAAGG - Intronic
1009550836 6:65089405-65089427 GAGATAGTTTTGGAACTTAAAGG + Intronic
1009554694 6:65148397-65148419 GAGATCATTTTGGAACTTTAAGG - Intronic
1009627113 6:66148185-66148207 AAGATTACTTTGGAATTTTGTGG - Intergenic
1009699799 6:67161346-67161368 AAGATCATTTTGGAGCTTTTAGG + Intergenic
1009726624 6:67543403-67543425 GAGATCACCTTGGAACTTTAAGG + Intergenic
1009769079 6:68121645-68121667 GAGATTGTTTTGGAACTTTAAGG - Intergenic
1009804869 6:68590310-68590332 GAAATAATTTTGGAACTTTAAGG - Intergenic
1009945856 6:70341253-70341275 GAGAACATTTTGGAACTTTAAGG - Intergenic
1010061308 6:71625881-71625903 GAAATCATTTTGAAGCTTTAAGG + Intergenic
1010367337 6:75066670-75066692 AAGATCATATTAGAATTTGAGGG - Intergenic
1010458121 6:76082503-76082525 AAGATCACTTTGGCACCTTAAGG - Intergenic
1010498549 6:76566684-76566706 GAGATCATTTTGGAGCTTTAAGG - Intergenic
1010630128 6:78189320-78189342 AAGATCATTTTAGAGCCTTAAGG - Intergenic
1010650955 6:78455209-78455231 GAGATTATTTTGGAACTTTAAGG - Intergenic
1010660880 6:78569593-78569615 GACATTATTTTGGAGCTTTAAGG - Intergenic
1010674102 6:78721112-78721134 GACATCATTTTGGAACTTAAAGG + Intergenic
1010811484 6:80305253-80305275 AAAATCATTTGAGACCTTTATGG + Intronic
1010900608 6:81423184-81423206 GAGATCATTTTGAAACTTTAAGG + Intergenic
1010981649 6:82376219-82376241 GAGATCATTTTAGAACTCTAAGG - Intergenic
1011031809 6:82931584-82931606 GAGATCATTTTGGAACTTTAAGG + Intronic
1011041228 6:83032332-83032354 GAGATCATTTTGGAGCTTTAAGG + Intronic
1011148961 6:84247733-84247755 AAATTCATTTTGGAACTTGTTGG - Intergenic
1011347762 6:86390251-86390273 GAGGTCATTTTGGAATTTTAAGG + Intergenic
1011466964 6:87668161-87668183 AAGAGAATTATGGGACTTTAAGG + Intergenic
1011784280 6:90826670-90826692 GAGATCATTTTGGAACTTTAAGG + Intergenic
1011792784 6:90916018-90916040 GAGATTATTTTGGAACTTTAAGG + Intergenic
1011805885 6:91072130-91072152 GAGATCATTTTGATACTTTAAGG + Intergenic
1011845587 6:91560102-91560124 AAGATTATTTTGACTCTTTAAGG - Intergenic
1011870528 6:91886689-91886711 GAGATCATTTTGGAACTTTAAGG + Intergenic
1011895325 6:92217517-92217539 GAATTCATTTTGGAGCTTTAAGG + Intergenic
1011981633 6:93386400-93386422 GAGATCATTTTGGAACTTTAAGG - Intronic
1012045086 6:94263512-94263534 GAGATCACTTTGGAACTTTAAGG - Intergenic
1012064820 6:94537156-94537178 GAGATCATTTTGGAACTCTAAGG - Intergenic
1012068157 6:94576935-94576957 GGGATCATTTTGGACTTTTAAGG - Intergenic
1012078605 6:94727290-94727312 GCGATCACTTTGGAACTTTAAGG - Intergenic
1012097115 6:94976935-94976957 GAGATCATTTTAGAAAATTAAGG - Intergenic
1012239999 6:96860606-96860628 GAGATCATTTTGGAGCTTTAGGG + Intergenic
1012254505 6:97016392-97016414 GAGATCATTTTGGAACTTTAAGG + Intronic
1012706627 6:102539338-102539360 ATGATTATTTTAAAACTTTAAGG + Intergenic
1012963813 6:105651194-105651216 ATGATCATTTAGGAAATATATGG - Intergenic
1013146924 6:107403237-107403259 GAGGTCATTTTGGAACTTTAAGG - Intronic
1013549125 6:111190202-111190224 AAGATCGTTTTGGAACTTTAAGG - Intronic
1013910766 6:115273065-115273087 GAAGTCATTTTGGAACTTTAGGG + Intergenic
1014067630 6:117145535-117145557 GAGATAATTTTGAAAGTTTAAGG - Intergenic
1014116129 6:117670391-117670413 GTGATCATTTTGGAACTTTAAGG + Intergenic
1014143543 6:117971230-117971252 GAGATTATTTTGGAACTTGAAGG - Intronic
1014154235 6:118092731-118092753 GAGGTCATTTTGGAACTTTAAGG + Intronic
1014470059 6:121802259-121802281 GAGATCATTTTGGAACTTTAAGG + Intergenic
1014621621 6:123674572-123674594 GAGATCCTTTTGGAGCTTTAAGG - Intergenic
1014651208 6:124040147-124040169 AAGCTCATTTTGAAAATTTAAGG - Intronic
1014714631 6:124849547-124849569 GATATCATTTTGGAGCGTTAAGG + Intergenic
1014883000 6:126746178-126746200 GAGATCATTTTAAAAGTTTAAGG - Intergenic
1014951272 6:127558649-127558671 GAGATCATTTTGGAACTTTAAGG + Intronic
1014977937 6:127912145-127912167 GAAATCATTTTGGAACTTTAAGG + Intronic
1015039921 6:128704112-128704134 GAAATCATTTTGGAACTTTAAGG + Intergenic
1015045117 6:128767790-128767812 GAGATCATTTTGGAACTTTAAGG - Intergenic
1015212224 6:130711382-130711404 AAGAGCATTTTGAAACTCTGAGG + Intergenic
1015713052 6:136162849-136162871 GAGATCATTTTGGAACTTGAAGG - Intronic
1015899147 6:138046975-138046997 GAGATCATTTTGGAACTTTAAGG - Intergenic
1016020815 6:139235002-139235024 GAGATCATTATGGAACTTTAAGG + Intergenic
1016142201 6:140626579-140626601 GAGATCATTTTGGAACCTTAAGG - Intergenic
1016143564 6:140643513-140643535 GAGATCATTTTGGAACTTTAAGG - Intergenic
1016175298 6:141072079-141072101 GAGATCATTTTGGAACTTCAAGG + Intergenic
1016241308 6:141934715-141934737 GAGATAATTTTGGAACTTTAAGG + Intergenic
1016284895 6:142462356-142462378 GAGATAATTTTGGAACTTTAAGG - Intergenic
1016296048 6:142574542-142574564 GAGATCATTTTGGAACTTTAAGG + Intergenic
1016297706 6:142592889-142592911 AAGATTATTTTGGCACTCTTAGG - Intergenic
1016540637 6:145160020-145160042 TAGATCATTTTGGAGCTTTAAGG + Intergenic
1016587777 6:145708949-145708971 GAGATCATTTTGGAACTTTAAGG + Intronic
1016643582 6:146378476-146378498 GAGATAATTTTGGAACTTTAAGG + Intronic
1016653421 6:146489126-146489148 GAGAGCATTTTGGAATTTTCAGG - Intergenic
1016682270 6:146844864-146844886 GAAATCATTTTGGAACCTCAAGG - Intergenic
1016718087 6:147257575-147257597 AAGATTATTTTTTAATTTTATGG - Intronic
1016721621 6:147304775-147304797 GAGATCATTTTGGAAATTTAAGG + Intronic
1016785966 6:148011027-148011049 GAGATTATTTTGGAGCTTTAAGG + Intergenic
1017182648 6:151568196-151568218 AAGATCATTTCAGAAATTGAGGG - Intronic
1018086219 6:160303392-160303414 GAGATGATTTTGGAACTTTAAGG - Intergenic
1018261238 6:161972944-161972966 AATTTTATTTTGGAACTTAATGG + Intronic
1018477649 6:164159172-164159194 GAGATCATTTTAGAAGTTTAAGG - Intergenic
1018566803 6:165163135-165163157 GAGATCATTTTGGAACTTTAAGG - Intergenic
1018585251 6:165350294-165350316 TATATCATTTTGGAACTTTAAGG + Intronic
1019199234 6:170300777-170300799 GGGATCATTTTAGAACTTTAAGG - Intronic
1020407615 7:7854999-7855021 CAGAGTATTTTGGAACTCTAAGG - Intronic
1020457738 7:8393562-8393584 AAGGACATTTTGGAAATTTGTGG + Intergenic
1020493742 7:8821896-8821918 CAGATTCTTTTGGAACTTTGAGG - Intergenic
1020565284 7:9787560-9787582 AAGATGATGTTGGAGCTCTAAGG - Intergenic
1020581844 7:10012173-10012195 GAAATCATTTTGGAACTTTAAGG + Intergenic
1020729752 7:11866445-11866467 GAGATCATTTTGAAATTGTAAGG + Intergenic
1020782639 7:12535841-12535863 GAGATCATTTTGAAGCTTTAAGG - Intergenic
1020942880 7:14562608-14562630 GAGATCATTTTGGAACTCGAAGG + Intronic
1020958849 7:14777039-14777061 GAGATCATTTTTGAATTTTGAGG + Intronic
1021153545 7:17181239-17181261 ATGATACTTTTGGAACTGTATGG + Intergenic
1021325891 7:19267356-19267378 AAAATTATTTTTAAACTTTAAGG + Intergenic
1021401006 7:20209421-20209443 GAGATCATTCTGGAACTTTATGG + Intronic
1021470832 7:21000896-21000918 AACATCATTTTTGAACTCTAAGG - Intergenic
1021573243 7:22085667-22085689 GAGATCATTTTGGAACTTTAAGG - Intergenic
1021762341 7:23913843-23913865 GAGATCATTTTGGAACTTTAAGG + Intergenic
1022070574 7:26909496-26909518 AAAAACTTTTTGGAACTTTGTGG - Intronic
1022712508 7:32865053-32865075 GAGATTATTTTGGAGCTTTGAGG - Intergenic
1022910494 7:34895950-34895972 GAGATTATTTTGGAGCTTTGAGG + Intergenic
1023030916 7:36089767-36089789 AGGATTATTTTGGAGCTTTAAGG + Intergenic
1023208487 7:37776709-37776731 AAGATCATTTTGGAACTTTAAGG + Intronic
1023236931 7:38099551-38099573 GAGATCACTTTGGAACTTTAAGG + Intergenic
1024406496 7:48987988-48988010 GAGATTGTTTTGGAGCTTTAAGG + Intergenic
1024466899 7:49720947-49720969 AACATTATTTTGGAACTTCTTGG + Intergenic
1024645563 7:51367969-51367991 AAGATTAATTTGGAGCTTTAAGG - Intergenic
1024721118 7:52138668-52138690 GAGATCATTTTGGAACTTTAAGG - Intergenic
1025257633 7:57396059-57396081 ATGATCACTTAGGAAATTTAGGG - Intergenic
1025741453 7:64200375-64200397 AATGTCATTTTTGTACTTTAGGG + Intronic
1027395200 7:77746853-77746875 GGGATTATTTTGGAGCTTTAAGG - Intronic
1027506430 7:79021497-79021519 CAGATTATTTTAGAACTTTAAGG + Intronic
1027977650 7:85179438-85179460 GAGATCATTTTGGAACTTTAAGG + Intronic
1028032486 7:85933334-85933356 GAGATCATTTTGGAACCTTAAGG + Intergenic
1028045132 7:86108164-86108186 GAGATCATTTTGGAAATTTAAGG + Intergenic
1028084290 7:86617288-86617310 GAGATCATTTTGGAACTTTAAGG + Intergenic
1028118532 7:87029530-87029552 AATATTATTTTGGAACTTGATGG + Intronic
1028190621 7:87846568-87846590 AAGACCACTTTGGAATTATATGG - Intronic
1028286693 7:89011646-89011668 GAGATCATTTTGGAACTTTAAGG - Intronic
1028493728 7:91441594-91441616 GAGATCATTTTGGAACTTTAAGG + Intergenic
1028664649 7:93327380-93327402 AAGATCTTTCTGAAACTTTTGGG + Intronic
1028914066 7:96239269-96239291 AAGATCATTTTGGATTTTCAAGG + Intronic
1029939398 7:104464163-104464185 AAGATTATTTTAGAACTTTAAGG - Intronic
1030527574 7:110672732-110672754 AGAATCATTTTGGAACTGTAAGG - Intronic
1030722316 7:112884567-112884589 GAGATCATTTTGGAACTTGGAGG - Intronic
1030732000 7:113001525-113001547 ACTATCATTTTTGAACTGTAAGG - Intergenic
1030834437 7:114265353-114265375 GAGATTATTTTGGAGCTTTCAGG - Intronic
1030907602 7:115206252-115206274 GAGATCATTTTCAAACTTTAAGG - Intergenic
1031064865 7:117094028-117094050 AAAATCATTTTGGTAATTTTGGG + Intronic
1031182239 7:118433341-118433363 GGGATTATTTTGGAGCTTTAAGG + Intergenic
1031194252 7:118591662-118591684 GAGATCATTTTGGAACTTTAAGG + Intergenic
1031301671 7:120068508-120068530 GAGATAATTTTGGAGTTTTAAGG + Intergenic
1031396857 7:121284668-121284690 GAGATCATTTTGTAACTTTAAGG - Intronic
1031584522 7:123518464-123518486 TAGATCATTTAGGACCTTGAAGG - Intronic
1031608305 7:123795072-123795094 GAGATAATTTTTTAACTTTAAGG + Intergenic
1031645647 7:124222000-124222022 GAGATCATTTTGGAACTTTAAGG + Intergenic
1031712179 7:125062405-125062427 AAGATTATCTTGAAATTTTATGG - Intergenic
1032732451 7:134657075-134657097 GAGATCATTTTGGAACTTTAAGG - Intronic
1032842523 7:135725635-135725657 AAAATCCATTTGGAATTTTAAGG + Intronic
1033072911 7:138221074-138221096 GAGATCATTTTGCAACTTTAAGG + Intergenic
1033256253 7:139804222-139804244 GAGATCATTTTGTAACTTTAAGG + Intronic
1033491954 7:141853024-141853046 GAGATCATTTTGGAACTTTAAGG - Intergenic
1033720984 7:144059411-144059433 AAAATAATTTTGGAACTTTAAGG - Intergenic
1033777612 7:144629850-144629872 TAGATCATTTTGGAACTTTAAGG + Intronic
1033871825 7:145763071-145763093 GAGATCATTTTGGAGCTTTAAGG + Intergenic
1033885104 7:145934522-145934544 GAGATCATTTTGGAACTTTAAGG + Intergenic
1033953389 7:146813401-146813423 GAGATAACTTTGGAATTTTAAGG + Intronic
1034040676 7:147873954-147873976 GAGATCATTTTGGAACTTTAAGG - Intronic
1034510628 7:151531872-151531894 AAGATCACTTTAGAACTTTAAGG - Intergenic
1034739754 7:153462871-153462893 GAGATCATTTTGGAACTTAAAGG + Intergenic
1034742989 7:153495584-153495606 GAGATCACTTTGGAGTTTTAAGG + Intergenic
1034751382 7:153571946-153571968 GAGATTATTTTGGAGCTTTAAGG + Intergenic
1034874446 7:154713128-154713150 AACACATTTTTGGAACTTTAAGG - Intronic
1034904729 7:154934134-154934156 GAGATCATTTTGGTGCATTAAGG - Intronic
1035128673 7:156630400-156630422 AAGATTATTTTGGAGCTTTAAGG + Intergenic
1036043401 8:5112363-5112385 ACGGTCATTTTGTAACATTAAGG + Intergenic
1036429488 8:8676507-8676529 GAGGTCATTGTGGAACTTGATGG + Intergenic
1037086576 8:14858005-14858027 AAGATAATTTGAGAACATTATGG + Intronic
1037108469 8:15138106-15138128 GAGATCATTTTGGAACTTTAAGG + Intronic
1037206078 8:16321257-16321279 GAGATCATTTTGGAACTTTAAGG + Intronic
1037660201 8:20919776-20919798 GAGATCATTTTGGAACTTTAAGG - Intergenic
1037979041 8:23237622-23237644 GAGATAATTTTGAAACTTTAAGG - Intergenic
1038608118 8:29031101-29031123 AAGTTCTTTTTGCAACTGTAAGG - Intronic
1038882839 8:31633845-31633867 AAGAGCATTGTGAAACTTAAAGG - Intergenic
1039071443 8:33652521-33652543 GAGACCATTTTGGAACTTTAAGG + Intergenic
1039102218 8:33952687-33952709 TAGATAATTTTGGAGGTTTAGGG - Intergenic
1039107344 8:34003872-34003894 GAGATCATTTTAGAACTCTAAGG - Intergenic
1040540147 8:48346576-48346598 GAGATCATTTTAGAACTTTAAGG + Intergenic
1040645080 8:49388399-49388421 GAGATCATTTTGGAACTTTAAGG + Intergenic
1040797241 8:51299746-51299768 GAGATCATTTAGGAACTTTCAGG - Intergenic
1041147528 8:54893197-54893219 AAAAGCATTTTGGAAACTTAAGG - Intergenic
1041392599 8:57360105-57360127 GAAATTATTTTGGAGCTTTAAGG + Intergenic
1041430743 8:57778164-57778186 GAGAGCATTTTGGAACTTTAAGG + Intergenic
1041470375 8:58201893-58201915 AAGATTATTTTGGCAATTCATGG - Intronic
1041538093 8:58951101-58951123 AATTTTATTTTAGAACTTTAAGG - Intronic
1041654531 8:60335817-60335839 GAGATCATTTTGGAACTTTAAGG + Intergenic
1041849929 8:62379097-62379119 GAGATAAGTTTGGAAATTTAAGG + Intronic
1041852146 8:62404031-62404053 GAGATAAGTTTGTAACTTTAAGG + Intronic
1041901512 8:62988057-62988079 GAGATCATTTTGGAAATTTAAGG - Intronic
1042053053 8:64732327-64732349 GAGATCATTTTGGAACTTTAAGG + Intronic
1042164953 8:65936113-65936135 GAGATCATTTTGGAACTTTAAGG + Intergenic
1042601510 8:70503560-70503582 GAGATCATCTTGGAACTTTAAGG + Intergenic
1042868042 8:73372696-73372718 GGGATCACTTTGGAACTTTAAGG + Intergenic
1043346077 8:79299470-79299492 AAGATGATTATAGAACTTTCGGG + Intergenic
1043370397 8:79584213-79584235 GAGATCATTTAGGAATTTTAAGG + Intergenic
1043371201 8:79594990-79595012 TAGATCATTTTAGTTCTTTAAGG - Intergenic
1043559329 8:81471891-81471913 AAGATCATTTTGGCCATTTGGGG + Intergenic
1043794304 8:84516530-84516552 AAGTTCATTTTGAAACTCTTTGG + Intronic
1044055998 8:87570138-87570160 GGGATCATTCTGGAACTTTAAGG + Intronic
1044126994 8:88471467-88471489 GAGATCATTTTGGAACTTTAAGG - Intergenic
1044188507 8:89284316-89284338 GTGATCATTTAGGAACTTTAAGG + Intergenic
1044220365 8:89663044-89663066 GAAATCACTTTGGAACTCTAAGG - Intergenic
1044441362 8:92228065-92228087 CAAATAATTGTGGAACTTTAAGG - Intergenic
1044879771 8:96712102-96712124 GAGATCATTTTGTAACTTTAAGG - Intronic
1045271547 8:100666262-100666284 AAGAGCATTTTGGGAATTTGTGG + Intergenic
1045588100 8:103562429-103562451 GAGACTGTTTTGGAACTTTAAGG - Intronic
1045783100 8:105890787-105890809 AAGATCATTTTGGCTATTAAGGG - Intergenic
1045884349 8:107078458-107078480 GAGATTATTCTGGAACTTTAAGG - Intergenic
1045919371 8:107511552-107511574 GAGATCATTTTGGAACTTTAAGG + Intergenic
1046034305 8:108822156-108822178 GAGATTAATTTGGAACTTTAAGG + Intergenic
1046107488 8:109683361-109683383 GAGAGCATTTTGGAACTTTAAGG + Intronic
1046170442 8:110498314-110498336 GAGATCATTTTGGAACCTTAAGG + Intergenic
1046264501 8:111813871-111813893 GAGATCATTTTTGAACTTTAAGG - Intergenic
1046300086 8:112276170-112276192 AAGATTATTTTGGAGCTTTAAGG - Intronic
1046309507 8:112415780-112415802 AAGATCATTTTGGAATTTTAAGG + Intronic
1046499451 8:115056818-115056840 AAAAACATTTTGGATTTTTATGG + Intergenic
1046607686 8:116389267-116389289 GAGATCATTTTGGAACATTAAGG + Intergenic
1046786413 8:118271758-118271780 GAGATCACTTTGGAACTTTAAGG - Intronic
1046880135 8:119298808-119298830 AAGATCATTTTGGAACTTTAAGG - Intergenic
1046917471 8:119692504-119692526 GAGATCATTTTGGAACTTTAAGG + Intergenic
1047486042 8:125331568-125331590 AAGATCGTTTTTAAACTTCAGGG - Intronic
1047565655 8:126040915-126040937 GAGAACATTTTGGCACTTTAAGG + Intergenic
1047917982 8:129603471-129603493 GAGATCATTTTGGAACTTTAAGG - Intergenic
1047938881 8:129808206-129808228 AGGATTATTTTGGAGCTTTAGGG + Intergenic
1048416726 8:134235167-134235189 AAAATTATTTTGGAACTTTAAGG - Intergenic
1048434054 8:134399379-134399401 ATGATGATTTTGAGACTTTAGGG - Intergenic
1048694687 8:137012823-137012845 GAGATCATTTTGGAACTTTAAGG - Intergenic
1048781582 8:138007613-138007635 GAGATCATTTTGGAACTTTAAGG + Intergenic
1050086618 9:1972648-1972670 GAGATTATTTCAGAACTTTAAGG + Intergenic
1050121629 9:2314293-2314315 GAGATCATTTTGGAATTTTAAGG + Intergenic
1050255305 9:3787250-3787272 GAGATCATTTTAGAACTTTAAGG - Intergenic
1050415277 9:5409734-5409756 AAGATCAGTTTGGAGCTTTAAGG + Intronic
1050508571 9:6371329-6371351 GAGATCATTTTGGAACTTTAAGG + Intergenic
1050773540 9:9233753-9233775 GAGATCATTTTGGAACTTTAAGG - Intronic
1050945468 9:11511360-11511382 GCGATCATTTGGTAACTTTAAGG + Intergenic
1051194297 9:14546788-14546810 GAGGTTATTTTGGAGCTTTAAGG - Intergenic
1051267608 9:15323756-15323778 GAAATCATTTTGGAATTTTAAGG + Intergenic
1051567495 9:18517154-18517176 AAGATCATTTGCAAACCTTATGG + Intronic
1051984197 9:23063315-23063337 GAGATCATTTTGGGACTTCAAGG - Intergenic
1051984376 9:23064721-23064743 GAGATCATTTTGGGAATTTAAGG - Intergenic
1052040973 9:23738657-23738679 AAAATCATTTAGAAACTTTGGGG - Intronic
1052053895 9:23882294-23882316 GAGATCATTTTGGAAGTTTAAGG - Intergenic
1052086213 9:24269156-24269178 GAAATCATTTAGGAAATTTAAGG - Intergenic
1052221616 9:26031168-26031190 AAAATCTTTCTGGAACTTCATGG + Intergenic
1052518116 9:29509877-29509899 GAGATTATTTTGGAACTTTAAGG - Intergenic
1052526919 9:29630056-29630078 GAGATTATTTTGAAACTTTAAGG + Intergenic
1052577722 9:30311757-30311779 GAGATTATTTTGGAACTTTGAGG - Intergenic
1052689779 9:31802385-31802407 GAGATCATTTTGGAGCTTTAAGG + Intergenic
1053371267 9:37563798-37563820 GAGATCATTTCGGAATTTTAAGG + Intronic
1053371410 9:37564619-37564641 GAGATCATTTTGGAACTTTAAGG + Intronic
1053572024 9:39319236-39319258 GAGAACATTTTGGAACTTTAAGG + Intergenic
1053615781 9:39764672-39764694 AAGATCGTTTTGACTCTTTAGGG - Intergenic
1053780934 9:41606415-41606437 GACATCATTTTGAAACTTTAAGG + Intergenic
1053873951 9:42523965-42523987 AAGATCGTTTTGACTCTTTAGGG - Intergenic
1053898671 9:42770607-42770629 AAGATCGTTTTGACTCTTTAGGG + Intergenic
1054093578 9:60877947-60877969 GAGAACATTTTGGAACTTTAAGG + Intergenic
1054115061 9:61153867-61153889 GAGAACATTTTGGAACTTTAAGG + Intergenic
1054125121 9:61299775-61299797 GAGAACATTTTGGAACTTTAAGG - Intergenic
1054168877 9:61816572-61816594 GACATCATTTTGAAACTTTAAGG + Intergenic
1054237739 9:62577719-62577741 AAGATCGTTTTGACTCTTTAGGG + Intergenic
1054268382 9:62942791-62942813 AAGATCGTTTTGACTCTTTAGGG + Intergenic
1054551871 9:66612226-66612248 AAGATCGTTTTGACTCTTTAGGG + Intergenic
1054592695 9:67028667-67028689 GAGAACATTTTGGAACTTTAAGG - Intergenic
1054668654 9:67764239-67764261 GACATCATTTTGAAACTTTAAGG - Intergenic
1054876500 9:70102707-70102729 AAAATCTATTTGGAAGTTTATGG + Intronic
1055021606 9:71675800-71675822 AAGATTATTTTCAAGCTTTAAGG + Intergenic
1055142058 9:72887162-72887184 GAGATCATTTTGGAGCTTTAAGG + Intergenic
1055170803 9:73255444-73255466 AAGATCATTTTGGAGCTTTAAGG + Intergenic
1055225426 9:73989563-73989585 GAGATCATTTTGGACCTTTAAGG - Intergenic
1055390088 9:75811266-75811288 AAGATAATTTAAGAAATTTATGG + Intergenic
1055774311 9:79751650-79751672 AAGATCATTTTGGAACTTTAAGG - Intergenic
1055848401 9:80594863-80594885 GAGATCATTTTGGAACTTTAAGG + Intergenic
1056042772 9:82685443-82685465 AAGATCATTTTGGAACTTTAAGG - Intergenic
1056064112 9:82915844-82915866 GAGATCATATTGGAATTTTATGG - Intergenic
1056149006 9:83765669-83765691 GAGATCATTTCGGAACTTTAAGG + Intronic
1056312295 9:85352795-85352817 GAAATTATTTTGGAGCTTTAAGG - Intergenic
1056670385 9:88622935-88622957 AAGATTATGTTGGAGCTTTAAGG - Intergenic
1058101870 9:100925375-100925397 GAGATCATTTTGGAACTTTAAGG + Intergenic
1058210395 9:102161132-102161154 GAGGTCATTTTGGAACTTTAAGG - Intergenic
1058223081 9:102326316-102326338 GAGATTATTTTGGAGTTTTAAGG + Intergenic
1058240262 9:102548712-102548734 GAGATCATCTTGGAAATTTAAGG + Intergenic
1058393589 9:104524625-104524647 GAGATCGTTTTAGAACTTCAAGG - Intergenic
1058546826 9:106069499-106069521 AAGATAATTTTGGCAGATTAAGG + Intergenic
1058940577 9:109809373-109809395 GAGATAATTTTGGAACTTTAAGG + Intronic
1059045548 9:110862143-110862165 GATGTCATTTTGGAACTTTAAGG + Intergenic
1059513933 9:114875614-114875636 GAGATCATTTTGGAACTTTAAGG - Intergenic
1059617491 9:115967083-115967105 GAGATTATTTTGGAGCTTTAAGG - Intergenic
1059826821 9:118039366-118039388 AAGTTCATTTTGGGACATTGTGG - Intergenic
1059843250 9:118242588-118242610 GAGATGATTTTGGAACTTTAAGG - Intergenic
1060019644 9:120117916-120117938 GAGATTGTTTTGGAACTTTAAGG + Intergenic
1060025101 9:120164206-120164228 AAGATCAATTTGGATCCTTCAGG - Intergenic
1060643539 9:125259349-125259371 AAGATTCTTTTGCAACTTTTGGG + Intergenic
1203716933 Un_KI270742v1:160793-160815 GACGGCATTTTGGAACTTTAAGG - Intergenic
1203534279 Un_KI270743v1:17442-17464 GATGGCATTTTGGAACTTTAAGG + Intergenic
1186666075 X:11719008-11719030 AAAATCATATTGGAATTTAAAGG + Intergenic
1186679241 X:11854645-11854667 GAGATCATTTTGGAACTTTAAGG - Intergenic
1186704560 X:12127900-12127922 GAGATCATTTTGGAACTTTAAGG - Intergenic
1186797571 X:13061914-13061936 GAGATCATTTTGGAGCTTTAAGG - Intergenic
1186926152 X:14335469-14335491 AAGATCATCTTGTAACTTTAAGG - Intergenic
1187097140 X:16161223-16161245 GAGATCATTTTGGAACTTTAAGG - Intergenic
1188041777 X:25376917-25376939 GAGACCATTTTGGAACCTTAAGG + Intergenic
1188055979 X:25541681-25541703 GAGATCATTTTGGAACTTTAAGG - Intergenic
1188062423 X:25617830-25617852 GAGATCATTTTGGAACTTTAAGG - Intergenic
1188114933 X:26231523-26231545 AAGATTATTTTGGAACTTTAAGG - Intergenic
1188134969 X:26483894-26483916 GAGATCATTTTGTAAATTTAAGG + Intergenic
1188719606 X:33506332-33506354 CAGCCCATTATGGAACTTTAAGG + Intergenic
1188749323 X:33885596-33885618 AAGATCATTTTGGAACTTTAAGG + Intergenic
1188865234 X:35305839-35305861 CAGATCATTTTGGAAATTTAAGG + Intergenic
1188888783 X:35583561-35583583 AGGATTACTTTGGAGCTTTAAGG + Intergenic
1189071230 X:37866250-37866272 GAGAACATTTTGGAACTTTAAGG - Intronic
1189604303 X:42660239-42660261 GAGATCATTTTGGAACTTTAAGG + Intergenic
1189638429 X:43039088-43039110 AAGAAAATTTTGGACATTTAAGG + Intergenic
1189788785 X:44583746-44583768 GAAATCATTTCGGAATTTTAAGG + Intergenic
1190153433 X:47967353-47967375 AAGGTTATTTTGGAGCTTTAAGG + Intronic
1190473705 X:50807907-50807929 AAGATCACTTTGGCTCTTTCTGG - Intronic
1190514373 X:51207445-51207467 GAGATCCTTTTGGAACTTTAAGG + Intergenic
1190531743 X:51385828-51385850 GAGATCATTTTGGAACTTTAAGG - Intergenic
1190703525 X:53006148-53006170 AAGATTATGTTGGAGATTTAAGG - Intergenic
1190971606 X:55355087-55355109 AAGATAAGTTTAGAACTTAAGGG - Intergenic
1191034785 X:56013181-56013203 GAGATTATTTTGGAACTTTAAGG + Intergenic
1191211390 X:57888995-57889017 GAGATTATTTTGGAACTTTAAGG - Intergenic
1191697607 X:64005787-64005809 GAGACCATTTTGAAACTTGAAGG - Intergenic
1191740365 X:64431183-64431205 TATGTCATTTTTGAACTTTAGGG - Intergenic
1192335689 X:70217390-70217412 GAGATCATTTTGGAACTTTAAGG + Intergenic
1192816925 X:74603360-74603382 AAGATCTCGTTGGATCTTTAAGG - Intronic
1192842005 X:74866239-74866261 GAGATCACATTGGAACTTTAAGG + Intronic
1192887936 X:75356773-75356795 AAGATTATTTTGGCTATTTAGGG + Intergenic
1192967531 X:76195220-76195242 GAGATTATTTTGGAACTTTAAGG - Intergenic
1193008198 X:76644367-76644389 GAGATATTTTTGAAACTTTAAGG + Intergenic
1193199039 X:78666154-78666176 GAGATCATTTTGGAACTTTATGG + Intergenic
1193210573 X:78802291-78802313 GAGATCTTTTTGGAACTTTAAGG + Intergenic
1193286687 X:79722808-79722830 CAGTTTATTTTGGAACTCTAAGG + Intergenic
1193316465 X:80071442-80071464 GAGATCATATTGGAACCTTAAGG - Intergenic
1193388256 X:80895585-80895607 GAGATTACTTTGGAACTTTAAGG + Intergenic
1193467252 X:81865279-81865301 GAGATCATTGTGGAATTTTAAGG - Intergenic
1193475049 X:81953488-81953510 TATGTCATTTTTGAACTTTAGGG - Intergenic
1193682803 X:84542115-84542137 GAGTTCATTTTGGAACTTTAAGG + Intergenic
1193816136 X:86107083-86107105 AAGATTATTTTGGAAGTTTAAGG - Intergenic
1193840629 X:86404472-86404494 GAGATAATTTTGGAACTTTAAGG - Intronic
1193887878 X:87006134-87006156 AAGATCACTTTGGAACTTTAAGG - Intergenic
1193891035 X:87046190-87046212 GATATCATTTTGAAACTTGAAGG + Intergenic
1193930619 X:87546815-87546837 GAGATTATTTTTGAGCTTTAAGG + Intronic
1193950186 X:87787944-87787966 GAGATCATTTTAAAACTTTAAGG - Intergenic
1193973805 X:88091811-88091833 TACGTCATTTTTGAACTTTAGGG + Intergenic
1193999762 X:88413188-88413210 AAGATTATTTGGTAACTTTTTGG - Intergenic
1194019444 X:88668805-88668827 AAGATTATTATGGAACTTTAAGG - Intergenic
1194034589 X:88854702-88854724 GAGATCATTTAGGAGCTTTAAGG + Intergenic
1194049576 X:89052822-89052844 GAGATCTTTTTGGAACTTTAAGG - Intergenic
1194053748 X:89104792-89104814 GATATTATTTTGGAACTTTATGG - Intergenic
1194054633 X:89116830-89116852 GAGATTATTTTGGAACTTTAAGG - Intergenic
1194089011 X:89563205-89563227 GAGACCATTTTGGAGCTTTAAGG - Intergenic
1194166896 X:90527946-90527968 TATGTCATTTTTGAACTTTAGGG - Intergenic
1194184936 X:90764706-90764728 AATATCATTTTGTAGCTTTAGGG - Intergenic
1194200941 X:90952198-90952220 TAGATTATTTTGGAGCTTTAAGG + Intergenic
1194534198 X:95085697-95085719 GAGATCATTTTAGAACTTTAAGG - Intergenic
1194542327 X:95189994-95190016 TAGATCTTTTCGGAACTTTAAGG - Intergenic
1194548515 X:95268905-95268927 GAGATTATTATGGAACTTTAAGG - Intergenic
1194560390 X:95412245-95412267 TATATCATTTTGGAACTTTAAGG + Intergenic
1194582896 X:95697958-95697980 GGGATTATTTTGGAACTTTAAGG + Intergenic
1194624501 X:96212934-96212956 GAGATCATTTTGGAATTTTAAGG - Intergenic
1194688637 X:96955725-96955747 GAGATCATTTCGGAACTCTGAGG - Intronic
1194784213 X:98062469-98062491 AGGATTATTTTAGAACTTTGAGG - Intergenic
1194788408 X:98115924-98115946 AGGATTATTTTGGAATTATAAGG - Intergenic
1194893343 X:99407149-99407171 GAGATCATTTTGGAACTTTAAGG + Intergenic
1194906016 X:99576833-99576855 GAGATCATTTTGGAACTTTAAGG + Intergenic
1195050158 X:101089529-101089551 AGGATCACTTTGGAAAGTTAAGG + Intronic
1195536372 X:106013214-106013236 CAGAACATTTTGGAACTTTAAGG + Intergenic
1195816837 X:108897118-108897140 ATGATAATTTTGGAACTTTAAGG + Intergenic
1195838899 X:109150479-109150501 GAGATCATTTTGGAACTTTGAGG + Intergenic
1196099192 X:111830124-111830146 GAGATCATTTTGAAACTTCAAGG + Intronic
1196173717 X:112617376-112617398 GAGATCATTTTGGAACTTTAAGG + Intergenic
1196309150 X:114141213-114141235 AATATGATTTTGTAACTTTATGG + Intergenic
1196547062 X:116974975-116974997 GAGATCATTTTGTAACTTTAAGG + Intergenic
1196930350 X:120675720-120675742 GAGATCATTTTGAAACTTTAAGG - Intergenic
1197088605 X:122509888-122509910 GTGATCATTTTGGAACTTTATGG - Intergenic
1197089550 X:122520811-122520833 GTGATCGTTTTGGAACTTTATGG - Intergenic
1197092960 X:122560177-122560199 AAAAGAATTTTGGAACTTGAAGG + Intergenic
1197094220 X:122574427-122574449 GAGATTATTTTGGAACTTTAAGG - Intergenic
1197109417 X:122755565-122755587 GAGATCATTTTGAAACTTTAAGG - Intergenic
1197451812 X:126628861-126628883 GAGATCATTTTGGAACTTTAAGG - Intergenic
1197464351 X:126784553-126784575 GAGATCATTATGGAACTTTAAGG + Intergenic
1197941461 X:131794501-131794523 AAGATTATTTTTGAACTATATGG - Intergenic
1198243826 X:134809713-134809735 AACGTCATTTTGGAGATTTATGG - Intronic
1198274743 X:135089901-135089923 GAGATAATTTTGGAACTTTAAGG + Intergenic
1198497088 X:137203815-137203837 GAGATCATTTTGGAGCTTTAAGG - Intergenic
1198566137 X:137907161-137907183 GAGATCTTTTTGGAACTTTAAGG + Intergenic
1198612583 X:138418333-138418355 GAGATCATTTTGGAACTTTAAGG + Intergenic
1198775349 X:140173181-140173203 GGGATCATTTTGGAAATTTAAGG + Intergenic
1198825724 X:140696146-140696168 GAGATCATTTTGGAACTTTAAGG - Intergenic
1198912894 X:141634026-141634048 GAGATCATGTTGGAACTTTAAGG + Intronic
1198966949 X:142237401-142237423 AAGATCATTTTGGAACTTTAAGG + Intergenic
1199060489 X:143350533-143350555 GAGATCATTTTGGAATTTTAAGG - Intergenic
1199112889 X:143955714-143955736 AAGATCACTTTGAAGCTTTAAGG + Intergenic
1199127336 X:144138743-144138765 GAGATAATTTTGGGACTTTAAGG - Intergenic
1199154959 X:144536459-144536481 GAGATCATTTTAGAACTTTAAGG - Intergenic
1199170869 X:144733250-144733272 AAGGTCATTTTGGAACTTTAAGG - Intergenic
1199185408 X:144910260-144910282 GAAATCATTCTGGATCTTTAAGG - Intergenic
1199193361 X:144997741-144997763 GAGATCATTTTGGGACTTAAAGG + Intergenic
1199223446 X:145343703-145343725 AAGATTATTTTGGAGCTGTAAGG - Intergenic
1199249194 X:145639675-145639697 GAGGTCATTTTGGAACTTTAAGG + Intergenic
1199301655 X:146220746-146220768 GAGATCATTTTGGAACTTTTAGG - Intergenic
1199346436 X:146746522-146746544 GAGATCATTTTAGAACTTTAAGG - Intergenic
1199400771 X:147395864-147395886 GAGATGATTTTGGAACTTCAAGG + Intergenic
1199515188 X:148668138-148668160 GAGATCATTTTGGAGCTTTAAGG - Intronic
1199560602 X:149159140-149159162 GAGATCATTTTGGAACTTTAAGG - Intergenic
1199580848 X:149358395-149358417 GAGATGATTTTGGAACTTTAAGG + Intergenic
1199619484 X:149686462-149686484 GAGATCATTTTGGAAATTTAAGG + Intergenic
1199701747 X:150383485-150383507 AAAAGCATTTTGTAACTTTCTGG + Intronic
1199868718 X:151877345-151877367 AAGATTGTTTTGGAGTTTTAAGG - Intergenic
1199908684 X:152261570-152261592 GACATCATTTTGGAACTTTAAGG - Intronic
1199929705 X:152506120-152506142 GAGGTCATTTTGGAACTTTAAGG - Intergenic
1199999390 X:153049878-153049900 GAGATCATTTTGGAACTTTAAGG + Intergenic
1200016763 X:153170496-153170518 GAGATCATTTTGGAACTTTAAGG + Intergenic
1200295295 X:154913669-154913691 GAGAACATTTTGGAACTTTCAGG - Intronic
1200441680 Y:3219255-3219277 GAGATCATTTTGGAGCTTTAAGG - Intergenic
1200513162 Y:4105722-4105744 TATGTCATTTTTGAACTTTAGGG - Intergenic
1200531560 Y:4346815-4346837 AATATCATTTTGTAGCTTTAGGG - Intergenic
1200546787 Y:4527656-4527678 TAGATTATTTTGGAGCTTTAAGG + Intergenic
1200700831 Y:6401031-6401053 CAGATCTTTTTGGATGTTTAAGG + Intergenic
1200707564 Y:6455981-6456003 CAGATCCTTTTGGAACCTTACGG + Intergenic
1200708240 Y:6461359-6461381 CAGATCTTTTTGGATCCTTAGGG + Intergenic
1200921922 Y:8620887-8620909 CAGATCATTTTGGAACCTTAGGG - Intergenic
1200922703 Y:8627368-8627390 AAGATTATTTTGAATCATTAGGG - Intergenic
1200923440 Y:8633171-8633193 CAGATCTTTTTGGATCATTAGGG - Intergenic
1200926404 Y:8658760-8658782 CAGATCCTTTTGGACCCTTAGGG - Intergenic
1200928858 Y:8679020-8679042 TAGATCCTTTTGGATTTTTAGGG + Intergenic
1200935210 Y:8732453-8732475 CAGATCATTTTGGATCCTTAGGG + Intergenic
1200937201 Y:8748750-8748772 CAGATCCTTTTGGATCCTTATGG + Intergenic
1200961681 Y:9001710-9001732 CAGATCTTTTTGGATCCTTAGGG - Intergenic
1200963059 Y:9012497-9012519 AAGATCCTTTTGGACCCTTAGGG - Intergenic
1200963483 Y:9015807-9015829 TAGATCGTTTTGGATCCTTAGGG + Intergenic
1200963777 Y:9018315-9018337 CAGATTCTTTTGGAACATTAGGG + Intergenic
1201025872 Y:9703349-9703371 CAGATCTTTTTGGATCCTTAGGG - Intergenic
1201026548 Y:9708727-9708749 CAGATCCTTTTGGAACCTTACGG - Intergenic
1201033281 Y:9763667-9763689 CAGATCTTTTTGGATGTTTAAGG - Intergenic
1201171121 Y:11265741-11265763 GATGGCATTTTGGAACTTTAAGG - Intergenic
1202024174 Y:20502588-20502610 AAGAGCATTTTGGCCCTCTATGG + Intergenic
1202099846 Y:21295694-21295716 AAGATATTTTTGGAACTTTGGGG - Intergenic
1202129896 Y:21600112-21600134 CAGATAATTTTGGATCCTTATGG + Intergenic
1202130228 Y:21602553-21602575 CAGATTATTTTGGATCCTTAGGG + Intergenic
1202149624 Y:21832967-21832989 TAGATCCTTTTGGATCCTTAGGG - Intergenic
1202150042 Y:21836285-21836307 AAGATCCTTTTGGACCCTTAGGG + Intergenic
1202178128 Y:22116421-22116443 CAGATCCTTTTGGATCTGTACGG + Intergenic
1202180112 Y:22132558-22132580 TAGATCCTTTTGGATCCTTAGGG + Intergenic
1202182224 Y:22149426-22149448 CAGATCCTTTTGGATCCTTAGGG + Intergenic
1202182364 Y:22150518-22150540 CAGATCACTTTGGATCGTTATGG + Intergenic
1202208996 Y:22435884-22435906 CAGATCACTTTGGATCGTTATGG - Intergenic
1202209136 Y:22436976-22436998 CAGATCCTTTTGGATCCTTAGGG - Intergenic
1202211248 Y:22453841-22453863 TAGATCCTTTTGGATCCTTAGGG - Intergenic
1202213233 Y:22469974-22469996 CAGATCCTTTTGGATCTGTACGG - Intergenic
1202305976 Y:23471501-23471523 AATGTCTTTCTGGAACTTTATGG + Intergenic
1202564833 Y:26199088-26199110 AATGTCTTTCTGGAACTTTATGG - Intergenic