ID: 1055774312

View in Genome Browser
Species Human (GRCh38)
Location 9:79751660-79751682
Sequence GGAGTCAAAAAAGATCATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055774312_1055774317 13 Left 1055774312 9:79751660-79751682 CCAAAATGATCTTTTTTGACTCC No data
Right 1055774317 9:79751696-79751718 GGGTGCGTTGATGCAAGATGTGG No data
1055774312_1055774319 23 Left 1055774312 9:79751660-79751682 CCAAAATGATCTTTTTTGACTCC No data
Right 1055774319 9:79751706-79751728 ATGCAAGATGTGGGCTCCCATGG No data
1055774312_1055774314 -7 Left 1055774312 9:79751660-79751682 CCAAAATGATCTTTTTTGACTCC No data
Right 1055774314 9:79751676-79751698 TGACTCCATTCTCACATCCAGGG No data
1055774312_1055774318 14 Left 1055774312 9:79751660-79751682 CCAAAATGATCTTTTTTGACTCC No data
Right 1055774318 9:79751697-79751719 GGTGCGTTGATGCAAGATGTGGG No data
1055774312_1055774313 -8 Left 1055774312 9:79751660-79751682 CCAAAATGATCTTTTTTGACTCC No data
Right 1055774313 9:79751675-79751697 TTGACTCCATTCTCACATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055774312 Original CRISPR GGAGTCAAAAAAGATCATTT TGG (reversed) Intergenic
No off target data available for this crispr