ID: 1055774315

View in Genome Browser
Species Human (GRCh38)
Location 9:79751681-79751703
Sequence ACGCACCCTGGATGTGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055774315_1055774317 -8 Left 1055774315 9:79751681-79751703 CCATTCTCACATCCAGGGTGCGT No data
Right 1055774317 9:79751696-79751718 GGGTGCGTTGATGCAAGATGTGG No data
1055774315_1055774318 -7 Left 1055774315 9:79751681-79751703 CCATTCTCACATCCAGGGTGCGT No data
Right 1055774318 9:79751697-79751719 GGTGCGTTGATGCAAGATGTGGG No data
1055774315_1055774319 2 Left 1055774315 9:79751681-79751703 CCATTCTCACATCCAGGGTGCGT No data
Right 1055774319 9:79751706-79751728 ATGCAAGATGTGGGCTCCCATGG No data
1055774315_1055774323 26 Left 1055774315 9:79751681-79751703 CCATTCTCACATCCAGGGTGCGT No data
Right 1055774323 9:79751730-79751752 CTTGTGCAGCTCTGCCCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055774315 Original CRISPR ACGCACCCTGGATGTGAGAA TGG (reversed) Intergenic
No off target data available for this crispr