ID: 1055774318

View in Genome Browser
Species Human (GRCh38)
Location 9:79751697-79751719
Sequence GGTGCGTTGATGCAAGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055774311_1055774318 24 Left 1055774311 9:79751650-79751672 CCTTAAAGTTCCAAAATGATCTT 0: 36
1: 258
2: 346
3: 318
4: 526
Right 1055774318 9:79751697-79751719 GGTGCGTTGATGCAAGATGTGGG No data
1055774312_1055774318 14 Left 1055774312 9:79751660-79751682 CCAAAATGATCTTTTTTGACTCC No data
Right 1055774318 9:79751697-79751719 GGTGCGTTGATGCAAGATGTGGG No data
1055774315_1055774318 -7 Left 1055774315 9:79751681-79751703 CCATTCTCACATCCAGGGTGCGT No data
Right 1055774318 9:79751697-79751719 GGTGCGTTGATGCAAGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055774318 Original CRISPR GGTGCGTTGATGCAAGATGT GGG Intergenic
No off target data available for this crispr