ID: 1055774319

View in Genome Browser
Species Human (GRCh38)
Location 9:79751706-79751728
Sequence ATGCAAGATGTGGGCTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055774316_1055774319 -10 Left 1055774316 9:79751693-79751715 CCAGGGTGCGTTGATGCAAGATG No data
Right 1055774319 9:79751706-79751728 ATGCAAGATGTGGGCTCCCATGG No data
1055774312_1055774319 23 Left 1055774312 9:79751660-79751682 CCAAAATGATCTTTTTTGACTCC No data
Right 1055774319 9:79751706-79751728 ATGCAAGATGTGGGCTCCCATGG No data
1055774315_1055774319 2 Left 1055774315 9:79751681-79751703 CCATTCTCACATCCAGGGTGCGT No data
Right 1055774319 9:79751706-79751728 ATGCAAGATGTGGGCTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055774319 Original CRISPR ATGCAAGATGTGGGCTCCCA TGG Intergenic
No off target data available for this crispr