ID: 1055776346 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:79770516-79770538 |
Sequence | CTTTCTAGTCAGAGCTACTT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1055776346_1055776350 | 16 | Left | 1055776346 | 9:79770516-79770538 | CCAAAGTAGCTCTGACTAGAAAG | No data | ||
Right | 1055776350 | 9:79770555-79770577 | CTGCCCTTGCCCAGCAATATTGG | No data | ||||
1055776346_1055776356 | 29 | Left | 1055776346 | 9:79770516-79770538 | CCAAAGTAGCTCTGACTAGAAAG | No data | ||
Right | 1055776356 | 9:79770568-79770590 | GCAATATTGGGCAAGCCATTTGG | No data | ||||
1055776346_1055776351 | 17 | Left | 1055776346 | 9:79770516-79770538 | CCAAAGTAGCTCTGACTAGAAAG | No data | ||
Right | 1055776351 | 9:79770556-79770578 | TGCCCTTGCCCAGCAATATTGGG | No data | ||||
1055776346_1055776357 | 30 | Left | 1055776346 | 9:79770516-79770538 | CCAAAGTAGCTCTGACTAGAAAG | No data | ||
Right | 1055776357 | 9:79770569-79770591 | CAATATTGGGCAAGCCATTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1055776346 | Original CRISPR | CTTTCTAGTCAGAGCTACTT TGG (reversed) | Intergenic | ||
No off target data available for this crispr |