ID: 1055776346

View in Genome Browser
Species Human (GRCh38)
Location 9:79770516-79770538
Sequence CTTTCTAGTCAGAGCTACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055776346_1055776350 16 Left 1055776346 9:79770516-79770538 CCAAAGTAGCTCTGACTAGAAAG No data
Right 1055776350 9:79770555-79770577 CTGCCCTTGCCCAGCAATATTGG No data
1055776346_1055776356 29 Left 1055776346 9:79770516-79770538 CCAAAGTAGCTCTGACTAGAAAG No data
Right 1055776356 9:79770568-79770590 GCAATATTGGGCAAGCCATTTGG No data
1055776346_1055776351 17 Left 1055776346 9:79770516-79770538 CCAAAGTAGCTCTGACTAGAAAG No data
Right 1055776351 9:79770556-79770578 TGCCCTTGCCCAGCAATATTGGG No data
1055776346_1055776357 30 Left 1055776346 9:79770516-79770538 CCAAAGTAGCTCTGACTAGAAAG No data
Right 1055776357 9:79770569-79770591 CAATATTGGGCAAGCCATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055776346 Original CRISPR CTTTCTAGTCAGAGCTACTT TGG (reversed) Intergenic
No off target data available for this crispr