ID: 1055778232

View in Genome Browser
Species Human (GRCh38)
Location 9:79790070-79790092
Sequence CTGTGGAAACAGTAGGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055778232_1055778239 -6 Left 1055778232 9:79790070-79790092 CCCCTCTCCTACTGTTTCCACAG No data
Right 1055778239 9:79790087-79790109 CCACAGCAGCATGGGTCCTGAGG No data
1055778232_1055778241 21 Left 1055778232 9:79790070-79790092 CCCCTCTCCTACTGTTTCCACAG No data
Right 1055778241 9:79790114-79790136 CTTGTCTGACACCGCACAAAAGG No data
1055778232_1055778242 28 Left 1055778232 9:79790070-79790092 CCCCTCTCCTACTGTTTCCACAG No data
Right 1055778242 9:79790121-79790143 GACACCGCACAAAAGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055778232 Original CRISPR CTGTGGAAACAGTAGGAGAG GGG (reversed) Intergenic
No off target data available for this crispr