ID: 1055780315

View in Genome Browser
Species Human (GRCh38)
Location 9:79814039-79814061
Sequence GTCTCTATGATGAAGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055780309_1055780315 15 Left 1055780309 9:79814001-79814023 CCTGGGTTATCGGATTGGCCAGT No data
Right 1055780315 9:79814039-79814061 GTCTCTATGATGAAGGAGGTAGG No data
1055780312_1055780315 -3 Left 1055780312 9:79814019-79814041 CCAGTCTGGGTCATAAGCTTGTC No data
Right 1055780315 9:79814039-79814061 GTCTCTATGATGAAGGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055780315 Original CRISPR GTCTCTATGATGAAGGAGGT AGG Intergenic
No off target data available for this crispr