ID: 1055781953

View in Genome Browser
Species Human (GRCh38)
Location 9:79830082-79830104
Sequence CAGTATGTTGAACCTCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055781953_1055781955 8 Left 1055781953 9:79830082-79830104 CCATCATGAGGTTCAACATACTG No data
Right 1055781955 9:79830113-79830135 TCCTACCCGAGCCTTACATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055781953 Original CRISPR CAGTATGTTGAACCTCATGA TGG (reversed) Intergenic
No off target data available for this crispr