ID: 1055783607

View in Genome Browser
Species Human (GRCh38)
Location 9:79847312-79847334
Sequence CAGAGAGAACAAAGGGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055783607_1055783612 8 Left 1055783607 9:79847312-79847334 CCCTTTGCCCTTTGTTCTCTCTG No data
Right 1055783612 9:79847343-79847365 AACTCTCATAATGCATATATTGG No data
1055783607_1055783613 20 Left 1055783607 9:79847312-79847334 CCCTTTGCCCTTTGTTCTCTCTG No data
Right 1055783613 9:79847355-79847377 GCATATATTGGTCCTCTTAATGG No data
1055783607_1055783614 21 Left 1055783607 9:79847312-79847334 CCCTTTGCCCTTTGTTCTCTCTG No data
Right 1055783614 9:79847356-79847378 CATATATTGGTCCTCTTAATGGG No data
1055783607_1055783615 22 Left 1055783607 9:79847312-79847334 CCCTTTGCCCTTTGTTCTCTCTG No data
Right 1055783615 9:79847357-79847379 ATATATTGGTCCTCTTAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055783607 Original CRISPR CAGAGAGAACAAAGGGCAAA GGG (reversed) Intergenic
No off target data available for this crispr