ID: 1055788872

View in Genome Browser
Species Human (GRCh38)
Location 9:79900121-79900143
Sequence GCTCTTTGTTGAGGTGTCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055788869_1055788872 25 Left 1055788869 9:79900073-79900095 CCTCAGCTTTCAAGTGTTATTTC No data
Right 1055788872 9:79900121-79900143 GCTCTTTGTTGAGGTGTCCTCGG No data
1055788868_1055788872 26 Left 1055788868 9:79900072-79900094 CCCTCAGCTTTCAAGTGTTATTT No data
Right 1055788872 9:79900121-79900143 GCTCTTTGTTGAGGTGTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055788872 Original CRISPR GCTCTTTGTTGAGGTGTCCT CGG Intergenic