ID: 1055789844

View in Genome Browser
Species Human (GRCh38)
Location 9:79911963-79911985
Sequence CGGTAAACAGCAGTGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055789833_1055789844 24 Left 1055789833 9:79911916-79911938 CCGTTCCTGATCCGGAGGTGGGG No data
Right 1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG No data
1055789835_1055789844 19 Left 1055789835 9:79911921-79911943 CCTGATCCGGAGGTGGGGAAGTC No data
Right 1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG No data
1055789837_1055789844 13 Left 1055789837 9:79911927-79911949 CCGGAGGTGGGGAAGTCAGCGGC No data
Right 1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055789844 Original CRISPR CGGTAAACAGCAGTGGTGGA CGG Intergenic
No off target data available for this crispr