ID: 1055792002

View in Genome Browser
Species Human (GRCh38)
Location 9:79932570-79932592
Sequence AATTCTAGAGCAACTGACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055792002_1055792006 12 Left 1055792002 9:79932570-79932592 CCTTAGTCAGTTGCTCTAGAATT No data
Right 1055792006 9:79932605-79932627 TGTGCCTCTGTTATGGGCCAGGG No data
1055792002_1055792007 13 Left 1055792002 9:79932570-79932592 CCTTAGTCAGTTGCTCTAGAATT No data
Right 1055792007 9:79932606-79932628 GTGCCTCTGTTATGGGCCAGGGG No data
1055792002_1055792004 6 Left 1055792002 9:79932570-79932592 CCTTAGTCAGTTGCTCTAGAATT No data
Right 1055792004 9:79932599-79932621 TCTTGCTGTGCCTCTGTTATGGG No data
1055792002_1055792005 11 Left 1055792002 9:79932570-79932592 CCTTAGTCAGTTGCTCTAGAATT No data
Right 1055792005 9:79932604-79932626 CTGTGCCTCTGTTATGGGCCAGG No data
1055792002_1055792003 5 Left 1055792002 9:79932570-79932592 CCTTAGTCAGTTGCTCTAGAATT No data
Right 1055792003 9:79932598-79932620 GTCTTGCTGTGCCTCTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055792002 Original CRISPR AATTCTAGAGCAACTGACTA AGG (reversed) Intergenic