ID: 1055792003

View in Genome Browser
Species Human (GRCh38)
Location 9:79932598-79932620
Sequence GTCTTGCTGTGCCTCTGTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055792002_1055792003 5 Left 1055792002 9:79932570-79932592 CCTTAGTCAGTTGCTCTAGAATT No data
Right 1055792003 9:79932598-79932620 GTCTTGCTGTGCCTCTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055792003 Original CRISPR GTCTTGCTGTGCCTCTGTTA TGG Intergenic