ID: 1055795155

View in Genome Browser
Species Human (GRCh38)
Location 9:79967932-79967954
Sequence CATCCACTGATTAAATTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055795155_1055795158 -2 Left 1055795155 9:79967932-79967954 CCTCCCAATTTAATCAGTGGATG No data
Right 1055795158 9:79967953-79967975 TGTGTAATATCAGTACTACCTGG No data
1055795155_1055795159 -1 Left 1055795155 9:79967932-79967954 CCTCCCAATTTAATCAGTGGATG No data
Right 1055795159 9:79967954-79967976 GTGTAATATCAGTACTACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055795155 Original CRISPR CATCCACTGATTAAATTGGG AGG (reversed) Intergenic
No off target data available for this crispr