ID: 1055795947

View in Genome Browser
Species Human (GRCh38)
Location 9:79975187-79975209
Sequence GGTCAGACGCTTCAAAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 126}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055795947_1055795958 21 Left 1055795947 9:79975187-79975209 CCCTTCCTTTGAAGCGTCTGACC 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1055795958 9:79975231-79975253 TGCTGGGAAGTGTAGTTCCTGGG No data
1055795947_1055795957 20 Left 1055795947 9:79975187-79975209 CCCTTCCTTTGAAGCGTCTGACC 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1055795957 9:79975230-79975252 ATGCTGGGAAGTGTAGTTCCTGG No data
1055795947_1055795954 4 Left 1055795947 9:79975187-79975209 CCCTTCCTTTGAAGCGTCTGACC 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1055795954 9:79975214-79975236 ATCCTAGTGGTAAGGAATGCTGG 0: 1
1: 0
2: 0
3: 11
4: 141
1055795947_1055795951 -9 Left 1055795947 9:79975187-79975209 CCCTTCCTTTGAAGCGTCTGACC 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1055795951 9:79975201-79975223 CGTCTGACCTGGAATCCTAGTGG 0: 1
1: 0
2: 2
3: 4
4: 54
1055795947_1055795952 -4 Left 1055795947 9:79975187-79975209 CCCTTCCTTTGAAGCGTCTGACC 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1055795952 9:79975206-79975228 GACCTGGAATCCTAGTGGTAAGG 0: 1
1: 0
2: 1
3: 7
4: 293
1055795947_1055795955 5 Left 1055795947 9:79975187-79975209 CCCTTCCTTTGAAGCGTCTGACC 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1055795955 9:79975215-79975237 TCCTAGTGGTAAGGAATGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 124
1055795947_1055795959 25 Left 1055795947 9:79975187-79975209 CCCTTCCTTTGAAGCGTCTGACC 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1055795959 9:79975235-79975257 GGGAAGTGTAGTTCCTGGGCAGG No data
1055795947_1055795960 26 Left 1055795947 9:79975187-79975209 CCCTTCCTTTGAAGCGTCTGACC 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1055795960 9:79975236-79975258 GGAAGTGTAGTTCCTGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055795947 Original CRISPR GGTCAGACGCTTCAAAGGAA GGG (reversed) Intergenic
900396616 1:2455659-2455681 AGTCAGAAGCTTCAGAGGAGCGG + Intronic
903395819 1:23001177-23001199 GTTGAGAAGATTCAAAGGAAGGG + Intergenic
904316431 1:29669101-29669123 GGTAAGAACCTTCAAAGGAAGGG + Intergenic
906318507 1:44802976-44802998 GGTCAGCCGTCTCAAAGGGAGGG - Exonic
908658474 1:66413201-66413223 GGGCAGGCACTTCAAGGGAAAGG + Intergenic
908826072 1:68133977-68133999 GCTCTGAAGCTTCAAAGCAAAGG + Intronic
910350592 1:86292815-86292837 AGTCAAAAGCTTCAAAGAAAAGG - Intergenic
911712281 1:101087998-101088020 GGTCATATTCTTAAAAGGAATGG - Intergenic
916793522 1:168145392-168145414 GGTCAGATACTCCAAGGGAAGGG + Intergenic
917633610 1:176914618-176914640 GGTCAGAAGCTACACAGGAATGG + Intronic
922204370 1:223433685-223433707 GGTCAGACAGCTGAAAGGAAGGG - Intergenic
1063382887 10:5597273-5597295 GCTCAGACGCTTCCAGGGATGGG - Intergenic
1064444649 10:15382787-15382809 GGTCAGACTCTTGAGAGGAGGGG - Intergenic
1068908933 10:62357879-62357901 GGTCAGGGACTTGAAAGGAAGGG + Intergenic
1069490584 10:68857249-68857271 GGTCAGACACTTCATAGGTGAGG + Intronic
1071599841 10:86953751-86953773 GGTCAGAGGTTTGCAAGGAATGG - Intronic
1073175637 10:101555199-101555221 GGTCAGACATTTAAAAGGCATGG + Exonic
1074056203 10:109924363-109924385 GGTGTCACGCTTCAAAGGACTGG - Intergenic
1074740983 10:116484129-116484151 GTTGAGAAGATTCAAAGGAAGGG - Intergenic
1078151406 11:8762426-8762448 GGTCAGACCCTTCACTGGGAAGG - Intronic
1083386522 11:62314918-62314940 GGTCAGAAACATCAAGGGAATGG - Intergenic
1083688971 11:64395183-64395205 GGTAAGACACTGCAGAGGAAGGG - Intergenic
1085012917 11:73153768-73153790 GGCCAGAGTCTTGAAAGGAAGGG - Intergenic
1087958564 11:104320048-104320070 GGTCAGACCCTATAAAGTAATGG - Intergenic
1089254653 11:117187878-117187900 GGTCGTGCCCTTCAAAGGAAAGG - Intronic
1090183032 11:124717702-124717724 GGTCATATGCTGGAAAGGAAGGG + Intergenic
1092496444 12:9000201-9000223 TGTCAGAAGATTCAAAGAAATGG + Intronic
1093750652 12:22795561-22795583 GAACAGACTCTTCACAGGAAAGG + Intergenic
1094280058 12:28726928-28726950 GCTCTAACGCTTCAAAGGACAGG - Intergenic
1094842347 12:34347412-34347434 GGTAAGAGGCTTGAAATGAAAGG - Intergenic
1096270995 12:50166659-50166681 GGCCAGACGTTCCAAGGGAAAGG - Intronic
1102005862 12:109588886-109588908 GGTCAGAGGCTACAAAGAGAAGG + Intronic
1102557158 12:113734637-113734659 TGTCAGAAGCTTCAAAAGGAGGG - Intergenic
1104949137 12:132431113-132431135 GGTCAGAGGCTGCAAACGACAGG + Intergenic
1105266296 13:18820301-18820323 GGACAGCCTCTTCAAATGAATGG + Intergenic
1105464843 13:20629946-20629968 GGTCAGACACTTTACATGAAAGG - Intronic
1106769894 13:32951927-32951949 GGTCAGAAGGTACAAAGAAAGGG - Intergenic
1109498593 13:63209062-63209084 GGTCTGAGGCCTCAAAGTAAAGG + Intergenic
1110546181 13:76758239-76758261 GGGCAGACACTGGAAAGGAAAGG - Intergenic
1112379327 13:98873592-98873614 GGTCATATCCTTAAAAGGAAAGG + Intronic
1113809020 13:113126364-113126386 GGACAGGGGCTGCAAAGGAAAGG + Intronic
1132547165 16:538649-538671 GGACAGAAGCTTCAAGGGCAGGG - Intronic
1134780599 16:16891771-16891793 GGTGAGAGGCTACAAAGGCAAGG + Intergenic
1136287442 16:29252836-29252858 GGGGAGACCCTTCAAAGGGAAGG + Intergenic
1138896699 16:61214566-61214588 GGTCAGACACTTCACAGAAGAGG + Intergenic
1139370986 16:66469359-66469381 GGGCAGAGGCTTCAGAGGAGAGG + Intronic
1139535993 16:67574203-67574225 GGTCAGAAGCTCTGAAGGAATGG - Intronic
1141021727 16:80502971-80502993 GTTCAGACGGTTCAAGGGCAGGG - Intergenic
1141268902 16:82521434-82521456 TGACAGACCCTTCAAAGTAATGG + Intergenic
1142093057 16:88225465-88225487 GGGGAGACCCTTCAAAGGGAAGG + Intergenic
1142424010 16:89991136-89991158 GGTCAGAGGTTTCCAAGGAGAGG + Intergenic
1148692472 17:49538558-49538580 GGTTCAAAGCTTCAAAGGAAAGG - Intergenic
1150910284 17:69380751-69380773 GGTCAGAGGAATCAAAGAAAGGG - Intergenic
1154422122 18:14241171-14241193 GGACAGCCTCTTCAAATGAATGG - Intergenic
1157200077 18:45652535-45652557 GGTCAGATCCTCCAAGGGAAAGG - Intronic
1157697611 18:49735500-49735522 GGTCTTACACTCCAAAGGAAGGG - Intergenic
1157725127 18:49958389-49958411 GGTCAGAAGCTTGAAGAGAATGG - Intronic
1157874600 18:51260554-51260576 TGGCAGATGCTGCAAAGGAAAGG - Intergenic
1162825646 19:13249914-13249936 GGTCACTCTCTTCAAAGGGATGG + Intronic
925526737 2:4811284-4811306 GGACAGATGCTTGAAAGCAAAGG - Intergenic
929443466 2:41984560-41984582 TGTCAGACCCTTCTCAGGAATGG - Intergenic
932053752 2:68424206-68424228 GGGCAGAAGTTTCAAAAGAATGG + Intergenic
933588846 2:84209245-84209267 AGTGAGACTCTTAAAAGGAAGGG - Intergenic
934037567 2:88101038-88101060 GGTCAGGCTCTCCTAAGGAAAGG - Intronic
934496017 2:94799957-94799979 GGACAGTCTCTTCAAATGAATGG + Intergenic
935447759 2:103174806-103174828 GGTCATAGGCTTAGAAGGAAAGG - Intergenic
937548807 2:123060336-123060358 AGGAAGACGCCTCAAAGGAAGGG - Intergenic
937822616 2:126327828-126327850 GGTCAAAGGTTTCAAGGGAAGGG + Intergenic
937861399 2:126714319-126714341 GTTCAGAGGCTGCAATGGAAAGG + Intergenic
939295540 2:140259200-140259222 ACTCAGAGGCTTCAAAGGACGGG + Intronic
943467886 2:188252161-188252183 AATCAGAGCCTTCAAAGGAAAGG + Intergenic
945041686 2:205747949-205747971 TGTCAGAGACTTCAAAGGAAAGG - Intronic
945690866 2:213033849-213033871 GGTTAAAAGCTTCAAAGGACAGG - Intronic
945911918 2:215659704-215659726 GGTCATACCCATCAAAGGGAGGG - Intergenic
946088530 2:217198575-217198597 GCTCCGAGGCTTGAAAGGAAAGG - Intergenic
1169107761 20:3011559-3011581 GGGCAGAAACTTCAAAGCAAAGG + Intronic
1171887335 20:30666705-30666727 GGACAGCCTCTTCAAATGAATGG + Intergenic
1172781115 20:37437551-37437573 GGAGAAACCCTTCAAAGGAATGG - Intergenic
1176851363 21:13918784-13918806 GGACAGCCTCTTCAAATGAATGG + Intergenic
1178395188 21:32236688-32236710 GGTCATGCCCTTAAAAGGAAGGG - Intergenic
1181438463 22:22923586-22923608 GTTCAGACACTTAAGAGGAATGG + Intergenic
1183637575 22:39073886-39073908 GGTCAGACGACTCAAAGTGAGGG + Intronic
952902620 3:38120208-38120230 GGTCAGAGGCTAGAAGGGAAGGG - Intronic
956328083 3:68075249-68075271 GGTCACAGGCTTCAATGGAAAGG - Intronic
958997289 3:100919048-100919070 GGCAAGAGGCTTCAAAGGCAGGG - Intronic
962886557 3:139633120-139633142 GGTCAGAAGTTTAAAATGAAGGG - Intronic
962954591 3:140252814-140252836 GCTCAGAGGCTTGAAAGGATAGG + Intronic
963243083 3:143030237-143030259 GGTTAAAAGCTTCAAAGGACAGG + Intronic
970202620 4:13625440-13625462 TGCCAGACCCTTCAAAGTAAAGG - Intronic
970605333 4:17675551-17675573 GCTCCAACGCTTCAAAGGACAGG - Intronic
976655030 4:87479490-87479512 GGTCACACTCCTCAAAGAAACGG + Exonic
978261760 4:106768421-106768443 GGACTCACCCTTCAAAGGAATGG - Intergenic
979843071 4:125470365-125470387 GGTTAAAAGCTTCAAAGGATAGG - Intronic
985905394 5:2831252-2831274 GATCAGACGTTTCATAGGACAGG - Intergenic
987737334 5:21864154-21864176 TGTAAGATGCTACAAAGGAATGG + Intronic
991105111 5:62834411-62834433 GGTCAGAAACTTCAGAGGGATGG + Intergenic
991467329 5:66927656-66927678 GGACAGACACTTGAGAGGAAAGG + Intronic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
999993026 5:157066197-157066219 AGTCAAATGCTGCAAAGGAAAGG + Intergenic
1003868588 6:10384188-10384210 GGGCAGTCTCCTCAAAGGAAAGG - Intergenic
1004176454 6:13344232-13344254 GGTCATACTCTTCAAGGGAAGGG + Intergenic
1006573285 6:35023169-35023191 GGTCAGAAGGGTCAAAGGGAAGG - Intronic
1015519632 6:134117417-134117439 ATTCAGGCGCCTCAAAGGAAGGG - Intergenic
1016653099 6:146485336-146485358 GGTCAAACTCTTGAAAGGCAAGG - Intergenic
1018366942 6:163130519-163130541 GGTCAGATGCTTCCAAAGACTGG - Intronic
1019082361 6:169443675-169443697 GGACAGACCCTTCAGAGGCAGGG + Intergenic
1020829983 7:13083234-13083256 GGGCAGACAGTTCAAAGTAATGG - Intergenic
1023645383 7:42307315-42307337 GCTCAAAAGCTTCAAAGGACAGG + Intergenic
1026399470 7:69994947-69994969 AGTCAGGCGCTACAAAGTAATGG - Intronic
1037977035 8:23221064-23221086 GGGCAGAAGGTTCTAAGGAATGG - Intronic
1038934275 8:32231112-32231134 GGTCAGAAGAAGCAAAGGAAAGG + Intronic
1041470941 8:58208381-58208403 GGTCAGAAGCCTGGAAGGAATGG + Intergenic
1042121727 8:65495717-65495739 GGTCAGACTATTCAATGGTAAGG + Intergenic
1053661126 9:40280427-40280449 GGACAGTCTCTTCAAATGAATGG - Intronic
1053911501 9:42909764-42909786 GGACAGTCTCTTCAAATGAATGG - Intergenic
1054362115 9:64133326-64133348 GGACAGCCTCTTCAAATGAATGG - Intergenic
1054373244 9:64426642-64426664 GGACAGTCTCTTCAAATGAATGG - Intergenic
1054523484 9:66095857-66095879 GGACAGTCTCTTCAAATGAATGG + Intergenic
1054680877 9:67916420-67916442 GGACAGTCTCTTCAAATGAATGG - Intergenic
1055240321 9:74177135-74177157 GGGCAGAAGCATCAAAAGAAAGG - Intergenic
1055795947 9:79975187-79975209 GGTCAGACGCTTCAAAGGAAGGG - Intergenic
1059210090 9:112505949-112505971 GGTGACACATTTCAAAGGAAAGG - Intronic
1059368966 9:113809599-113809621 AGTGAGAGGCTTCTAAGGAACGG - Intergenic
1061594291 9:131618982-131619004 AGGCACACGCTTCCAAGGAACGG + Intronic
1062583025 9:137236703-137236725 GGACAGAAGCTCCCAAGGAATGG + Intergenic
1187195782 X:17082248-17082270 GGTCTGAAACTTTAAAGGAATGG - Intronic
1192628950 X:72760219-72760241 AGTCTGACTGTTCAAAGGAAAGG - Intergenic
1192652760 X:72960595-72960617 AGTCTGACTGTTCAAAGGAAAGG + Intergenic
1193406173 X:81105458-81105480 GGACAGCCACTTCAAAGGAAGGG - Intergenic
1200185020 X:154176536-154176558 AGTCAGACGCTGAAAAGGAGGGG - Intergenic
1200190673 X:154213674-154213696 AGTCAGACGCTGAAAAGGAGGGG - Intergenic
1200196424 X:154251476-154251498 AGTCAGACGCTGAAAAGGAGGGG - Intergenic
1200202079 X:154288594-154288616 AGTCAGACGCTGAAAAGGAGGGG - Intronic