ID: 1055798284

View in Genome Browser
Species Human (GRCh38)
Location 9:80000625-80000647
Sequence CTGAATTTAAGAAGGAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055798284_1055798287 27 Left 1055798284 9:80000625-80000647 CCAGATCTCCTTCTTAAATTCAG No data
Right 1055798287 9:80000675-80000697 TTACTTTCTTGAGTGCTCTGTGG No data
1055798284_1055798288 28 Left 1055798284 9:80000625-80000647 CCAGATCTCCTTCTTAAATTCAG No data
Right 1055798288 9:80000676-80000698 TACTTTCTTGAGTGCTCTGTGGG No data
1055798284_1055798286 -6 Left 1055798284 9:80000625-80000647 CCAGATCTCCTTCTTAAATTCAG No data
Right 1055798286 9:80000642-80000664 ATTCAGAATCTGTTTCTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055798284 Original CRISPR CTGAATTTAAGAAGGAGATC TGG (reversed) Intergenic
No off target data available for this crispr