ID: 1055818143

View in Genome Browser
Species Human (GRCh38)
Location 9:80231702-80231724
Sequence AAACCTCCAAGGTCCCACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055818139_1055818143 -9 Left 1055818139 9:80231688-80231710 CCTCCTTGGTCCTAAAACCTCCA No data
Right 1055818143 9:80231702-80231724 AAACCTCCAAGGTCCCACCTTGG No data
1055818137_1055818143 12 Left 1055818137 9:80231667-80231689 CCTAGGTGTGGAGCTGGGAAACC 0: 8
1: 14
2: 38
3: 81
4: 235
Right 1055818143 9:80231702-80231724 AAACCTCCAAGGTCCCACCTTGG No data
1055818132_1055818143 24 Left 1055818132 9:80231655-80231677 CCCAAAAGTTTGCCTAGGTGTGG No data
Right 1055818143 9:80231702-80231724 AAACCTCCAAGGTCCCACCTTGG No data
1055818134_1055818143 23 Left 1055818134 9:80231656-80231678 CCAAAAGTTTGCCTAGGTGTGGA No data
Right 1055818143 9:80231702-80231724 AAACCTCCAAGGTCCCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055818143 Original CRISPR AAACCTCCAAGGTCCCACCT TGG Intergenic
No off target data available for this crispr