ID: 1055819846

View in Genome Browser
Species Human (GRCh38)
Location 9:80248498-80248520
Sequence CCTGGAAAGGACACAGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055819841_1055819846 10 Left 1055819841 9:80248465-80248487 CCTGGGTATTCTGGACAGAGGAA No data
Right 1055819846 9:80248498-80248520 CCTGGAAAGGACACAGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055819846 Original CRISPR CCTGGAAAGGACACAGTGGA TGG Intergenic
No off target data available for this crispr