ID: 1055821318

View in Genome Browser
Species Human (GRCh38)
Location 9:80267870-80267892
Sequence GAATTTATGAAGAGGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055821318_1055821321 -4 Left 1055821318 9:80267870-80267892 CCATCCATCCTCTTCATAAATTC No data
Right 1055821321 9:80267889-80267911 ATTCTCCTCCTAATGTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055821318 Original CRISPR GAATTTATGAAGAGGATGGA TGG (reversed) Intergenic
No off target data available for this crispr