ID: 1055824819

View in Genome Browser
Species Human (GRCh38)
Location 9:80311386-80311408
Sequence ATTCAGCCCACTATCTATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055824814_1055824819 21 Left 1055824814 9:80311342-80311364 CCTAGAATAAAGCAGGAGCTGAT No data
Right 1055824819 9:80311386-80311408 ATTCAGCCCACTATCTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055824819 Original CRISPR ATTCAGCCCACTATCTATTT TGG Intergenic
No off target data available for this crispr