ID: 1055826041

View in Genome Browser
Species Human (GRCh38)
Location 9:80325982-80326004
Sequence CTGTGTTACCAATGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055826041_1055826048 22 Left 1055826041 9:80325982-80326004 CCCACTTCCCATTGGTAACACAG No data
Right 1055826048 9:80326027-80326049 AAATGGTCCCTACAGAACTCAGG No data
1055826041_1055826046 -3 Left 1055826041 9:80325982-80326004 CCCACTTCCCATTGGTAACACAG No data
Right 1055826046 9:80326002-80326024 CAGAACTAGATTGAACTATTGGG No data
1055826041_1055826045 -4 Left 1055826041 9:80325982-80326004 CCCACTTCCCATTGGTAACACAG No data
Right 1055826045 9:80326001-80326023 ACAGAACTAGATTGAACTATTGG No data
1055826041_1055826047 5 Left 1055826041 9:80325982-80326004 CCCACTTCCCATTGGTAACACAG No data
Right 1055826047 9:80326010-80326032 GATTGAACTATTGGGTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055826041 Original CRISPR CTGTGTTACCAATGGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr