ID: 1055831677

View in Genome Browser
Species Human (GRCh38)
Location 9:80386464-80386486
Sequence GCAGCTTGTGGCATTGAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1055831671_1055831677 3 Left 1055831671 9:80386438-80386460 CCCGAAAGTACTAAGCCTTGTTT No data
Right 1055831677 9:80386464-80386486 GCAGCTTGTGGCATTGAATAGGG No data
1055831670_1055831677 15 Left 1055831670 9:80386426-80386448 CCTATGTCATGGCCCGAAAGTAC No data
Right 1055831677 9:80386464-80386486 GCAGCTTGTGGCATTGAATAGGG No data
1055831672_1055831677 2 Left 1055831672 9:80386439-80386461 CCGAAAGTACTAAGCCTTGTTTT No data
Right 1055831677 9:80386464-80386486 GCAGCTTGTGGCATTGAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1055831677 Original CRISPR GCAGCTTGTGGCATTGAATA GGG Intergenic
No off target data available for this crispr